Which of the following parts from Edgar Allan Poe's "The Black Cat" reveals information about the conflict in the story? "I was especially fond of animals, and was indulged by my parents with a great variety of pets." "...I withdrew my arm from her grasp and buried the axe in her brain." "Pluto had not a white hair upon any portion of his body; but this cat had a large, although indefinite splotch of white, covering nearly the whole region of the breast." "Upon touching [the cat] he immediately arose, purred loudly, rubbed against my hand, and appeared delighted with my notice."

Answers

Answer 1
id say it would be i withdrew my arm from her grasp and buried the axe in her brain.
Answer 2

Answer:

"...I withdrew my arm from her grasp and buried the axe in her brain."

Explanation:

In "The Black Cat," a questionable first-individual storyteller relates how alcohol and self-double dealing drove him to slaughter his pets and murder his significant other.

Feeling regretful after the homicide of his adored dark feline, Pluto, the storyteller embraces another feline—yet he can't get away from his blame or savage inclinations.


Related Questions

In the following sentence the word that the adverb clause modifies is _____.
The child burned his hand because he forgot that the burner was still on.
child
burned
was
forgot

Answers

in the following sentence the word that the adverb clause modifies is burned.hoped that helped!

Answer:

Burned

Explanation:

An adverb clause is a group of related words that have at least a subject and a verb, and whose function is to modify or add detail to adjectives, verbs or other adverbs. This type of clauses often answers why, how, when, where or in what circumstances something is done or takes place, and they begin with subordinating conjunctions like because, since, as, after, when, before an once.

In the sentence, then, the adverb clause is "because he forgot that the burner was still on" and the word it modifies is the main action (the verb): "burned" because it provides information of why the child burned his hand.

Elie Wiesel’s All Rivers Run to the Sea is a biography. memoir. scholarly study. fictional narrative.

Answers

its a memoir i hope this helps.

It should be noted that Elie Wiesel’s All Rivers Run to the Sea is a biography which is a memoir.

What is memoir ?

A memoir  can be regarded as a  nonfiction narrative writing which is usually written on author's personal memories.

Elie Wiesel’s All Rivers Run to the Sea is a biography and it is a memoir because it was written on author's personal memories.

Learn more about memoir at:

https://brainly.com/question/1293351

Which type of literature combines the amusing and the grim sides of life?
a. realistic drama
b. satire
c. tragicomedy
d. informational writing

Answers

C. Tragicomedy. Good Luck!

Which sentence is punctuated correctly? A. Note This letter needs to be mailed immediately. B. Note; This letter needs to be mailed immediately. C. Note, This letter needs to be mailed immediately. D. Note: This letter needs to be mailed immediately.

Answers

the answer is - Note: This letter needs to be mailed immediately.

The correct answer is D. Note: This letter needs to be mailed immediately.

Explanation:

In grammar there are multiple punctuation marks including the period (.); comma (,); the parentheses () and the colon (:) each used with a different purpose and according to different rules in the case of colon (:) this is a punctuation mark used to introduce a list, explanation or illustration of a previous element or clause. Additionally, in this case, it acceptable to capitalize the first word after the colon (:) which is not correct in the case of other punctuation marks such as the comma or semicolon. Considering this, the sentence that is punctuated correctly is "Note: This letter needs to be mailed immediately." because in this sentence it is correct to use the semicolon, because "This letter needs to be mailed immediately" explains or illustrates the word "Note", also, the word "This" has been capitalized which is only accepted in the case of colon (:) or period (.).

What is the author's main purpose in why leaves turn color in the fall?
A she wants to persuade readers to stop pollution
B she wants to inform readers of scientific facts about autumn leaves
C she wants to explain the origin of macabre fall holiday
D she wants to entertain readers with an imaginative fable about leaves

Answers

The answer to your answer is b

it is b for connexus

Hey guys, i have been doing my English and these are a few questions out of a large pile of them. I am just struggling a bit, and i cannot currently contact my teachers.

Here are the questions. I hope some of you understand my current position right now.
Note: I edited a couple question numbers, please note these aren't the questions in order of my test.

1. Which of the following topics is the clearest example of the informative purpose?
A. a short essay describing a recent trip to New Zealand
B. a eulogy for a deceased friend
C. a glowing movie review
D. a dialogue between two char

2. Gripping the rail, (*UNDERLINED* Lindsey stepped onto the ice. *UNDERLINED*)
A. independent clause
B. adjective clause
C. adverb clause
D. noun clause

3. The basket (*UNDERLINED* that she is holding *UNDERLINED*) is made from palm fronds
A. independent clause
B. adjective clause
C. adverb clause
D. noun clause

4. Which of the following sentences best reflects (*ITALICS* chronological order? *ITALICS*)
A. Many English academics consider Daniel Defoe to be the first modern novel writer.
B. He was born in London to James Foe, a butcher.
C. Defoe served as a secret agent for William II between 1697 and 1701, and between 1703 and 1714 for various ministers.
D. His most famous novels are Robinson Crusoe and Moll Flanders.

5. What would be the least effective detail for a description about a lazy summer evening in the country?
A. The old, frayed hammock swung gently from side to side in the light summer breeze.
B. Fallen leaves frantically chased after each other in swirling gusts of wind.
C. The two old men quietly sipped iced tea under a massive oak tree.
D. They could hear the crickets chirping serenely in the distance.

Answers

Here's what I think:
1. C. a glowing movie review
2. A. independent clause
3. C. adverb clause
4. C. Defoe served as a secret agent for William II between 1697 and 1701, and between 1703 and 1714 for various ministers.
5. B. Fallen leaves frantically chased after each other in swirling gusts of wind.

Complete each sentence using an appropriate option from the given options.

The topic which is the clearest example of the informative purpose is "a glowing movie review".

Gripping the rail, Lindsey stepped onto the ice.

Independent clause

The basket that she is holding is made from palm fronds

Adverb clause

Which of the following sentences best reflects chronological order?

Defoe served as a secret agent for William II between 1697 and 1701, and between 1703 and 1714 for various ministers.

The least effective detail for a description about a lazy summer evening in the country is

"Fallen leaves frantically chased after each other in swirling gusts of wind".

Learn more about sentence:

https://brainly.com/question/11352260

Which event does not happen on the zuckerman farm in the summer?
a. children play in the hay.
b. goose eggs hatch.
c. children cut and stack hay.
d. swallows and sparrows sing.?

Answers

The correct answer of the given question above would be option D. The event that did not happen on the Zuckerman farm in the summer is this:  swallows and sparrows sing. It is the birds that are singing and not the swallows and sparrows. Hope this is the answer that you are looking for. 

Which type of character would be most likely to grow and change within a story?

Static character
Flat character
Dynamic character
Simple character

Answers

Dynamic character. I think.

Answer:dynamic character

Explanation:

He rememabered seeing the blood bursting through that man's fingers in a flood, drenching his uniform. What is the gerund phrase

Answers

drenching his uniform would be the gerund phrase
"he rememberd seeing"

In "Nolan Bushnell" which of the following descriptions best reflects how Bushnell's first computer game was initially received?
a) it was moderately received mainly because Bushnell claims that the engineers were incompetent
b) it was a wild success selling thousands of games immediately for months
c) it was a major success but only for a few weeks until sales steadily dropped
d) it was well-received despite Bushnell's doubts about his product

Answers

The Correct answer is


A

It was Moderately received mainly because Bushnell claims that the engineers were incompetent

In "Nolan Bushnell" which of the following descriptions best reflects how Bushnell's first computer game was initially received it was moderately received mainly because Bushnell claims that the engineers were incompetent.

Who was Nolan Bushnell?

Electrical engineer and businessman Nolan Kay Bushnell is from the United States. He founded the Chuck E. Cheese's Pizza Time Theatre chain and Atari, Inc.

Nolan Bushnell is often regarded as the "father of electronic gaming" because he created Pong. In his garage, he experimented with various electronic ignition systems as well as a roller-skate-mounted propellant rocket as a child. He was born in Utah in 1943.

One of the pioneers of something like the video game industry, Nolan Bushnell has founded more than 20 businesses. He serves on the Anti-Aging Games board. Bushnell founded Catalyst Technologies in 1981 as a venture-capital partnership with the goal of transforming his ideas into successful businesses.

Learn more about Nolan Bushnell here:

https://brainly.com/question/2238788

#SPJ5



Read the excerpt from "The Most Dangerous Game,” by Richard Connell.

The dining room to which Ivan conducted him was in many ways remarkable. There was a medieval magnificence about it; it suggested a baronial hall of feudal times with its oaken panels, its high ceiling, its vast refectory table where twoscore men could sit down to eat. About the hall were mounted heads of many animals—lions, tigers, elephants, moose, bears; larger or more perfect specimens Rainsford had never seen. At the great table the general was sitting, alone.


The descriptive language presents a visual image of a room that is
1.cluttered
2.modern
3.haunted
4.grand

Answers

The correct answer is 4. Grand.

Explanation: In this excerpt from "The Most Dangerous Game,” by Richard Connell, the narrator describes General Zaroff's dining room as "remarkable", "magnificence", and "vast" - all the choice of words depicts a sense of granduer.

The descriptive language presents a visual image of the room as a 4.grand .

What is a Descriptive language?

Descriptive language serves as a technique that is been utilized in writing which gives a detailed description of a place or person.

In the excerpt, grand was used as Descriptive language to describe the General Zaroff's dining room as a magnificence one.

Learn more about Descriptive language at,;

https://brainly.com/question/14775032

Locate the complete verbal phrase in the following sentence. The boy playing the piano has spent much time in practice.

Answers

Final answer:

The complete verbal phrase in the sentence is 'playing the piano'. Verbal phrases are verb forms that function as nouns, adjectives, or adverbs in a sentence. In this case, the verbal phrase 'playing the piano' functions as an adjective, describing the boy.

Explanation:

The complete verbal phrase in the sentence is 'playing the piano'.

'Playing' is the present participle form of the verb 'play' and 'the piano' is the object of the verb. Together, they form the verbal phrase.

Verbal phrases are verb forms that function as nouns, adjectives, or adverbs in a sentence. In this case, the verbal phrase 'playing the piano' functions as an adjective, describing the boy.

Final answer:

The complete verbal phrase in the sentence 'The boy playing the piano has spent much time in practice' is 'playing the piano.'

Explanation:

The complete verbal phrase in the sentence 'The boy playing the piano has spent much time in practice' is 'playing the piano.'

A verbal phrase is a phrase that consists of a verbal (a verb form) along with its modifiers and complements. In this sentence, 'playing' is the present participle form of the verb 'play' and 'the piano' is its direct object. Together, they form the complete verbal phrase 'playing the piano.'

For example, in the sentence 'The boy playing the piano has spent much time in practice,' the subject is 'the boy,' the verb is 'has spent,' and the complete verbal phrase 'playing the piano' functions as an adjective, modifying 'the boy.'

Match the correct vocabulary word to the definition.

voice
Read Answer Items for Question 1

point of view
Read Answer Items for Question 1

tone
Read Answer Items for Question 1

first person point of view
Read Answer Items for Question 1

third person point of view
Read Answer Items for Question 1
Answer
A.
a story told from the perspective of the narrator who is usually part of the story where pronouns like "I," "me," and "mine" are used.
B.
the position from which a story is told.
C.
a story told from the perspective of an all knowing narrator where pronouns like "he," "she," and "they" are used.
D.
the way you imagine a text would sound if it was read aloud; this also conveys mood.
E.
the unique style of a writer that conveys their attitude and personality of their characters.

QUESTION 2

All fictional text has its own voice.
True
False

QUESTION 3

A non-fiction news article should have a voice.
True
False

QUESTION 4

When reading the two different versions of the Grasshopper and the Ant, you noticed that the story changed depending on whose perspective the story was told.
True
False

QUESTION 5

A memoir is told in third person point of view.
True
False

QUESTION 6

The tone of a business letter should be the same tone you would use in an email to your best friend.
True
False

QUESTION 7

In literature, authors strive to have a unique voice in their writing.
True
False

QUESTION 8

Third person point of view is a story told through the eyes of a narrator who may or may not be a participant in the story.
True
False

Answers

A - 1st person
B - Point of View
C - 3rd person
D - Tone
E - Voice
2) true 3) true 4)true 5) false 6) false 7) true 8) true


Which of the following do legal researchers try to avoid when choosing a source?


validity

reliability

authenticity

bias

Answers

The correct answer is D Bias

Answer:

Bias

Explanation:

Choosing an authentic and significant source is crucial to an effective 'research'. Thus, while choosing a source, Legal researchers focus mainly on the authenticity, reliability, and validity of a source as it would affect the output of their research. Thus, the authenticity is of supreme concern while the thing that the researchers try to avert is that the source should not be biased as research can never afford to be biased as the biased source would mislead the research into an undesired path and a research is done not for a specified group of people but for a vastly diverse audience. Hence, the researchers tend to avoid the source being prejudiced or biased and confirms the reliability of the source before referring to it.

Julia child's reputation as a(n) ____ was established when she first demonstrated gourmet cooking on television.

Answers

Julia child's reputation as a "cook"

If added at the end, which sentence would complete the paragraph by connecting back to the topic?

A.The average American household spends over $500 a year on water.
B.With a little effort, people could easily protect this resource by conserving it.
C.Another resource that people should think about protecting is energy.
D.Since seventy percent of the Earth is covered by water, there is a lot of water around.

Answers

B, i don't know what the passage is, but it sounds like it is describing the earth and it is the only one that is vague and not specific

It is B, im a 100% sure. I just

When Lauren told her friend the news, they both started weeping. They never thought they would be in different schools, let alone different cities. Claudia helped Lauren cram boxes full of her clothes, trinkets, and shoes. As the shelves and dressers in the room grew barer, Lauren grew more dejected. In paragraph 3, the word dejected means A) brave. B) strong. C) miserable. D) lighthearted.

Answers

I believe that the answer for your question would be C. miserable, as that is the definition of dejected. Hope this helps!

Answer:

Option C: Miserable.

The passage reveals that Lauren is upset and not feeling well regarding this change in her life (leaving school, moving to another city, leaving her friends behind). That is the reason why the word "dejected" denotes a hopelessness scenario for the protagonist.

Imagine you are reading an article about the goals of the National Archives to reduce its energy use. What two facts could help you know that this source is reliable and credible?

A.The information's status as primary or secondary
B.The information's topic and tone
C.The information's creator and date of publication
D.The information's relevance to politics

Answers

Well, as for me, two facts that could help you know that this source is reliable and credible is being revealed by the third option from the scale represented above - C.The information's creator and date of publication. The issue which you are going to describe demands the newest information which directly relates to nowadays' conditions and you should know that the creator is reliable person which related to this issue as well.

Correct answer:  

C. The information's creator and date of publication.

The information's creator and where the article is published should be reputable and solid.  A random blog by some guy is different from an article published in an established periodical and written by someone with credentials in the topic.  As to date of publication, you'd want to make sure the article was up-to-date with any current policies or actions being taken by the National Archives.

Some general  thoughts about how to assess sources of information you use:

Always examine the sources of information that the person or book or website uses.  Do they have actual sources of information or are they just presenting material without giving any backing or citations?  

Also examine the credentials of the author and publisher/website.  Is the author someone with training and a track record in the subject being covered?  (Example: A university professor in that subject area.)  If a website, does the website get cited by other agencies? If a book, has the book  been noted with any awards or strong reviews by knowledgeable people?

Does the person or site seek to offer objective information, or is it biased toward the support of only a particular position or agenda?  It's fine to take notice of sources that are biased, but then give attention to sources on BOTH sides of that bias, not just one side, so that you as a researcher can remain objective.

Read more on Brainly.com - https://brainly.com/question/9555462#readmore

In “The Colomber” by Dino Buzzati, the colomber pursues Stefano for most of Stefano’s life. Which type of conflict does the colomber’s pursuit illustrate? internal external friendly primary

Answers

The type of conflict that the colomber’s pursuit illustrate is external conflict.

What is Conflict?

This refers to the disagreement that occurs between two or more entities where there is a constant struggle between them.

Hence, we can see that the type of conflict that the colomber’s pursuit illustrate is external conflict.

This is because there is an external conflict between Colomber and Stefano where there is a constant struggle.

Read more about conflict here:

https://brainly.com/question/24769299

#SPJ1

In 'The Colomber' by Dino Buzzati, Stefano is faced with an external conflict, represented by the colomber's pursuit, which is the primary problem Stefano must overcome.

In the story The Colomber by Dino Buzzati, Stefano's pursuit by the colomber illustrates an external conflict. This is because the colomber represents a distinct entity that is in opposition to Stefano, thereby causing strife from an outside source. The presence of the colomber as a continual threat in Stefano's life introduces a primary problem or obstacle that he must contend with throughout the narrative. It is important to note that while external conflicts are presented with a character clashing against an outside force, there can often be internal aspects as they respond to these challenges and how it affects their actions and psychology.

The colomber's pursuit could be seen as reflective of Stefano's inner fears or as a tangible manifestation of destiny or fate, which he cannot escape. This primary conflict drives the plot forward and constitutes the central complication Stefano must face and resolve by the end of the story. Conflicts in literature are crucial as they create tension and interest, making the story more engaging for readers.

1.Describe what is ironic about “Charles” and “The Gift of the Magi”. Explain how each author uses irony and the effect that each story has on readers. Be sure to use details about the characters and their actions to support your answer.

Answers

Answer:

Hi!

The ironies for Charles and the Gift of the Magi are the following:

1- Laurie's mother, who considers herself an excellent parent, has raised a troublemaking child.

2- Laurie is responsible for all of the bad things he said Charles did.

Explanation:

The story was written to show that parents do not always see their children in an accurate light.

What's ironic about Charles is that Laurie's mother, who considers herself an excellent parent, has raised a troublemaking child. On top of that, the irony at the end of "The gift of the Magi" is that the narrator and readers are surprised when they find out that Laurie is responsible for all of the bad things he said Charles did.

Which best identifies a characteristic of historical fiction
a. everything is assumed to be factual.
b. puts the reader right there in the past
c. tells the story of a person told by the same person
d.ha has a rhythm and rhyme scheme?

Answers

Historical fiction in my opinion would be to put the reader right there in the past. So my best answer would be B.
b. puts the reader right there in the past  
Seems like the best option. 

The tone of Rilke’s “The Swan” can be described as _____. Select all that apply.

formal
informal
uplifting
whimsical

Answers

formal i think or uplifting........

Answer: Formal and uplifting.

In this poem, Rilke compares how humans live with the way the swan is. She argues that the awkward walk of the swan reflects our life, which is often awkward and difficult. However, the moment we die is like the moment the swan gets in the water. It is a smooth transition, after which it glides easily through infinity.

the two presidential candidates were deeply involved in debate which word is the adverb

Answers

"Deeply" is the adverb.

I haven’t had a seizure in seven years, but the doctors tell me that I am “susceptible to seizure activity.”

Isn’t that one of the worst phrases you’ve ever heard?

Susceptible to seizure activity.

Doesn’t that just roll off the tongue like poetry?

I also had a stutter and a lisp. Or maybe I should say I had a st-st-st-st-stutter and a lissssssssththththp.


Help fast
Which character trait does the characterization from the passage above reveal about Arnold?

sensitive
self-deprecating
cynical
compliant

Answers

i think its self deprecating

Answer:

self-deprecating

Explanation:

This is the characteristic that is most obviously observed in Arnold. He tells us that he is susceptible to seizure activity and that he has a stutter and a lisp. These characteristics would normally embarrass or worry other characters. However, Arnold talks about them naturally and with humour, making fun of himself and his situation. This shows that he is self-deprecating.

Rhetoric. What is an example of a rhetoric sentence?

Answers

He wanted nothing to do with her rhetoric(al) question.

Answer: You need to know that > Rhetoric is the art of using language effectively.

Explanation: Rhetoric uses persuasion or the act of convincing someone to do or believe something. Edge video

Example: The politician's rhetoric excited the crowd to rally around his campaign for revised carbon-emission standards.

The stage of plot in which setting is introduced is called?

Answers

The answer is Exposition

The purpose of flipping through a literature anthology is to help you _____.

choose research sources
help revise your draft
generate a topic
identify audience and purpose

Answers

the purpose of flipping through a literature anthology isi to help you :
Generate Topic
This will potentially served as your cube of inspiration from your literature

Hope this helps
Generate a topic.
Hope this helps.

Read the sentence.

Fast food causes obesity, so if I stop eating fast food, I will never become obese.

This claim is an example of a(n) __________.

Which option most accurately completes this sentence?

slippery slope
red herring
poisoning the well
ad hominem

Answers

Not ad hominem, because that has to be directed at a person. Probably not a red herring, because that involves misdirection and clues, which seems out of order for this type of work. Poisoning the well involves making further phrases seem stupid or pointless by statements made to start. A slippery slope is an action or idea that leads to problems and issues to come, and in this case i think that applies. 

A system of valid reasoning often used to determine cause and effect is called _____.
A.logic

b.post hoc

c.fallacy

d.identical

Answers

That would be A. Logic

Which identifies and explains the PRIMARY function of the underlined words?

That boy in the fourth row is Bella's cousin.
A) a dependent clause that modifies Bella
B) a prepositional phrase telling which boy
C) a noun phrase telling where to find the boy
D) an independent clause that modifies that boy
in the fourth row is underlined.

Answers

The correct answer you are looking for is...  B) a prepositional phrase telling which boy.
An dependent clause is a 'sentence' that relies on other information in order to make sense on its own. 
An independent clause can stand alone as a complete sentence (complete thought) without having to add any additional information.
Other Questions
How did airports encourage city growth ?a. they promoted the building of hotels, restaurants,services and rapid transit to accommodate travelers b. they are so big and require so much land that they need a larger population to be sustained c. they limit the effects of gridlock and make travel more pleasantd. they were responsible for transporting over 13 billion tons of materials Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Steam Workshop Downloader