what is one way to limit college tuition cost? a. take a summer and winter courses
b.take fewer courses per semester c.seek out government d. seek out state loans

Answers

Answer 1
a. take a summer and winter courses

Related Questions

How do convergent plate boundaries that have the same density to convert plate boundaries with different densities compare

Answers

Convergent boundaries with different densities will create subduction zones, where one plates slides under another.

Hope this helps!

HURRY! Why did General Sherman undertake his "March to the Sea"?

A. to reach and take Atlanta to control Georgia's transportation routes

B. to reach Tennessee to begin moving Union forces farther north

C. to inflict so much damage that Georgians would call for an end to the war

D. to gather food and forage for Sherman's starving soldiers and pack animals

Answers

i believe that it would be C
in the end he destroyed the south and ripped it in half causing them to weaken ending the war much easier,. 

The correct answer is C) to inflict so much damage that Georgians would call for an end to the war.

Sherman's March to the Sea was one of the most devastating military campaigns of the Civil War. Throughout the march, Sherman used the idea of total war. This meant the complete destruction of all useful food and resources for the Confederacy. In this march from Atlanta to Savannah, the Union troops would destroy millions of dollars worth of crops, thousands of miles worth of railroads, and would completely destroy the Confederacy's will to fight back. This strategy was supposed to destroy the moral of Southerners to force them to surrender and end the Civil War.

This strategy worked extremely well, as Sherman was able to capture a significant amount of land and left Georgia with very few resources left to use.

Strengthening a response by removing an unpleasant consequence is called

negative reinforcement
positive reinforcement
punishment
extinction

Answers

Final answer:

Negative reinforcement strengthens a response by removing an unpleasant consequence, while punishment decreases a behavior. Examples of negative reinforcement include seatbelt systems that beep until you buckle up, and examples of punishment include scolding a student to stop texting in class and taking away a favorite toy when a child misbehaves.

Explanation:

Negative reinforcement is the process of strengthening a response by removing an unpleasant consequence. For example, car manufacturers use negative reinforcement by having seatbelt systems that beep until you fasten your seatbelt, and the annoying sound stops when you exhibit the desired behavior. On the other hand, punishment is a mechanism that decreases a behavior. Positive punishment involves adding an undesirable stimulus to decrease a behavior, such as scolding a student to get them to stop texting in class. Negative punishment involves removing a pleasant stimulus to decrease behavior, like taking away a favorite toy when a child misbehaves.

The act of strengthening a response by removing an unpleasant consequence is called: negative reinforcement.

How to strengthen a response?

The act of strengthening a response by removing an unpleasant consequence is called negative reinforcement. This is a concept in operant conditioning where a behavior is strengthened by the removal of an aversive stimulus.

It is important to note that negative reinforcement is not the same as punishment, which is the application of an aversive stimulus to decrease a behavior.

Positive reinforcement, on the other hand, involves the addition of a pleasant stimulus to strengthen a behavior, while extinction refers to the gradual weakening and disappearance of a behavior due to the lack of reinforcement.

How and why did colonial resentment of British policies move from protest and demonstration to war and the Declaration of Independence between 1774 and 1776?

Answers

After the Boston Tea Party, the British enforced the Intolerable Acts. The colonists got together in the 1st Continental Congress to talk about what to do about the acts. They decided to boycott all British goods. After that, Lexington and Concord happened, and they got together once more at the 2nd continental Congress and decided to send the king the Olive Branch Petition which failed. They decided that peace wouldn't work, which caused the Declaration of independence to be signed.

PSYCHOLOGY QUESTION: Although psychologists provide several different services during therapy, a counseling psychologist differs from a clinical psychologist in that they __________.
A. usually treat mild disorders and help with daily challenges
B. provide group and individual therapy
C. focus on treating the disorder with drug therapy
D. provide a nursing diagnosis and treatment

Answers

Despite that psychologists provide several different services during a therapy, the counseling psychologist help them by treating mild disorders with daily challenges

A counseling psychologist means a profession who councils patients  and help them with therapy to help them overcome the issues.

A counseling psychologist is different from mental psychologists because they do not prescribe drugs like the latter does.

Hence, the counseling psychologist help them by treating mild disorders with daily challenges.

Therefore, the Option A is correct.

Read more about counseling psychologist

brainly.com/question/2214809

The overall conclusion of the Experience Sampling Method (ESM) research with regard to middle childhood is that it is a time of remarkable?

Answers

yes because its a time were a child never forgets stuff unless it has amnesia

Take a look at the figure. The chair shown is a variation on the style known as 
 A. Windsor.
 B. Adam
 C. Mission.
 D. Chippendale.

Answers

I believe the answer is A. Windsor
A windsor chair is built with solid seat made from wood with the legs and the chair-back are round and tetoned.
The upright of the back and the back of the legs are continuous and the the seats on this chair will be carved to shallow shapes in order to provide some sense of comfort for those who sit on it
the answer is 100 percent a,windsor. page 38 on your study guide.

which general area of policy is generally left up to the central government
A) Health
B) Interstate commerce
C) Education
D) Police
E) Voting requirements

Answers

The answer is A) Health :)

What is Close reading ?

Answers

Close reading is thoughtful, critical analysis of a text that focuses on significant details or patterns in order to develop a deep, precise understanding of the text's form, craft, meanings, etc. It is a key requirement of the Common Core State Standards and directs the reader's attention to the text itself.

Which type of fall is responsible for the highest percentage of overall deaths in construction?

A.
From girders
B.
From ladders
C.
From roofs
D.
From scaffolds

Answers

Answer:

C. From roofs

Explanation:

Falls from roofs account for more than one-third of deaths in construction. Many of them fall from the edge of the roof and the reason why they are not following many safety regulations can vary from country to country. Some countries are seeing safety regulations going down in favor of the construction firms or in some countries those regulations are not accounting for every danger in construction.

why did the court believe that Gideon could not defend himself?

Answers

Gideon was an unexperienced man in terms of the law. He was underprepared and did not defend himself well. Hope this helps you.

Slimy snails slide sideways what kind of sentence is this

Answers

Alliteration. How are you in High School AP?

Answer:

Alliteration

Explanation:

This is alliteration because there is an occurrence of the same letter or sound at the beginning of most of these words.

help I cannot figure this out!!

Of the following, which are considered the six general values? 9 and this is a check off list btw)

Responsibility

Relationships

Compassion

Courage

Achievement

Recognition

Hope

Peace

Answers

Hey You! Here Are The Six General Values:

• Compassion

• Courage

• Relationship

• Achievment

• Recognition

• Responsibility

I Really Hope This Helped You, Good Luck With Your Studies! ;)

Which of the following should employers do to actively prevent workplace hazard

Answers

to provide orientation training to all workers to make sure they understand potential hazards and prevention methods helps employers to actively prevent workplace hazard. making sure they comprehend these hazards and methods helps them to know what step of action to take when a situation considered hazardous can be prevented or resolved. 

-hope this helps

Answer choices are:

A. Completely eliminate all possible hazards.

B. Institute medical programs that do not include on site first aid

C. Plan for emergencies by rarely conducting training and emergency drills.

D. Provide orientation training to all workers to make sure they understand potential hazards and prevention methods.

____________________________________________________________

Correct answer choice is:

D. Provide orientation training to all workers to make sure they understand potential hazards and prevention methods.

____________________________________________________________

Explanation:

In order to regulate workplace hazards and excrete or decrease the jeopardy, you should consider the subsequent steps:

1. Recognize the hazard by carrying out a workplace risk evaluation;

2. Discover how workers might be in danger;

3. Estimate the hazards;

4. Document and analysis risks at least yearly, or earlier if something varies.

Feral children point strongly to the conclusion that our personality comes from our

Answers

Cultural environment, hope this helps ;)
Cultural environment I’m pretty sure :)

Fire is a common component of forest biomes. As more of build homes in these areas, can we protect people from natural disturbances? How? us

Answers

No, we can not protect them against natural disturbances because we can't stop natural or the run of things! The can help there selves from like fires so there won't be a big damage done and that would for them to build there homes out of brick or something of the sort so there hold house don't burn down!
Hope this helps have a nice day

Andy is in a grief group and seems "stuck" in his sorrow over the death of his father. The leader realizes that Andy needs to work on this issue even though the group is coming to a close. He believes that Andy could best benefit by a technique that will allow him to openly express his emotions. In this case, the group leader should make an ethical decision to:

Answers

im not sure but i would say that the group leader should make an ethical decision to recognize the potential adverse effects of techniques used to elicit emotions and take precautions to ensure that there is time to process.

-hope to helps

A therapist challenges her client to journal daily as a part of her treatment plan. The therapist offers her client a new music download if she meets this challenge for one week. This is an example of

positive reinforcement
negative reinforcement
extinction
punishment

Answers

Positive reinforcement

A(n) ______close to a cover letter leads to more interviews because you are contacting the employer.

Answers

An active close to a cover letter leads to more interviews because you are contacting the employer

What were the key factors in the Sui- Tang era that made for the restoration of a strong, unified Chinese empire after centuries of division and turmoil?

Answers

Hello!

Feudalism and centralized rule, as well as tributary system over conquered territories.

I hope this answer helped you! :)

True or false: A commercial driver who refuses to sumbit to a breath, urine or blood test will be permenently disqualified from operating a commercial vehicle

Answers

the answer is true because he had alcohol or something by the style  

The PSAT's MyRoad resource contains _____ profiles of academic fields.A. 50B. 10C. 67D. 88

Answers

Planning for College and a Career Each ReadiStep test taker receives free access to MyRoad, an online tool that helps middle school children start exploring college and career choices that meet their interests. MyRoad includes a personality profiler, overviews of 65+ academic subjects, and more. Thus, option C is correct.

What PSAT's MyRoad resource contains academic fields?

Two subsections make up the PSAT Maths section: a 25-minute no-calculator section and a 45-minute calculator-optional component. There are a total of 48 questions in these sections, including 8 “grid-in” questions and 40 multiple-choice questions.

Your aptitude for spotting and correcting grammatical problems, as well as editing words and phrases to make material better, will be evaluated on the PSAT's Writing and Language part.

Therefore, The Standard English Conventions' topic covers a number of topics, such as the use of parallel construction, parallelism, and verb agreement.

Learn more about academic fields here:

https://brainly.com/question/28301684

3SPJ2

If a robot were to do all that a human can do: What are the main things that the robot brain would need to do? Choose two functions and describe them. What parts of the human brain do what you have described?

Answers

Final answer:

The robot brain would need to perform motor control and cognitive processing functions.

Explanation:

If a robot were to do all that a human can do, its brain would need to perform various functions. Two important functions that the robot brain would need to do are motor control and cognitive processing.

Motor control involves coordinating and controlling the movements of the robot's physical body. This function is responsible for allowing the robot to walk, pick up objects, manipulate tools, and perform other physical actions. In humans, motor control is primarily controlled by the motor cortex in the brain.

Cognitive processing refers to the robot's ability to think, reason, perceive, and process information. This function enables the robot to understand its environment, make decisions, learn from experiences, and engage in complex problem solving. In humans, cognitive processing involves various brain regions, such as the prefrontal cortex, hippocampus, and temporal lobes.

Mary is an authorized user on her parents' credit card. What may happen if Mary doesn't use the card in a responsible way?

Answers

 If Mary doesn't use the credit card in a responsible  way, she will not have control of her expenses and may use up all the credit limit set by her parents? This will cause her being barred from using the card for more important needs. This may affect the use of the principal  cards also. 

Today, Singapore encourages larger families, depending on their

A education.
B religion.
C age.
D economic resources.

Answers

i thnk it is age hope it helps
D. is the answer to this question

Identify and explain two examples from the Greek city states and or Persia of attitudes toward society and social structure

Answers

The city-states were quite diverse and everyone fulfilled their designated roles, but they also interacted as well. Social classes applied only to men, as women took their social status from their husbands. In the social classes there were free people and slaves, who worked in all industries in the city-states, and even went to war of behalf of the city-states when needed.

Why is an MSA an imperfect measurement for assessing a functional area?

Answers

MSA's may overlap and cause several large metropolitan areas to come so close together that they form one continuous urban complex. 

Hope this helps! :D 

What were the primary purpose of state militias?
a. To protect states from the federal government and each other
b. To provide emergency support during natural disasters
c. To protect from attacks by Native Americans
d. To build infrastructure for new towns

Answers

A best describes the best reasons wht militias are a thing.

Answer:

The correct answer is C. The primary purpose of state militias was to protect from attacks by Native Americans.

Explanation:

The state militias were created prior to the sanction of the Constitution in 1787, as a means of defense of each state outside the armed forces controlled by the federal government. Its main objective was to provide for the defense of the territory of each state, while the federal army did the same at the borders of the nation. As the states were in peaceful coexistence under the Articles of Confederation, the main threat that the militias faced were the attacks of Native Americans.

Mickey's bowling score is 16 less than 3 times Minnie's score. The sum of their scores is 228. Find the score of each.

Answers

106 + 16 = 122

106 + 122 = 228

Mickey's score is 106, and Minnie's score is 122.

I hope this helped you out! :)

A student should speak to his or her ______ about which scholarship websites can be trusted.
a.guidance counselor
b.high school registrar
c.dean
d.college registrar

Answers

Answer: guidance counselor

Explanation: a-p-e-x

Other Questions
John Adams Alien and Sedition Acts influenced the election of 1800 because can someone plz help me. Which of the following best describes the Battle of Britain? A. The bombardment of northern France to prepare for a British invasion of continental Europe B. The German sea landing on the southern coast of Britain C. An air battle above the English Channel to prepare for an invasion of Britain D. The sea battle between German U-boats and British battleships Why did the united states get involved in the korean war? what was the outcome of the war? By establishing this link between the levels of cooperation observed in _____ with local forest conditions, rustagi et al. have increased the confidence that scholars can have in the external validity of results from previous experiments carried out all over the world, with student and nonstudent subjects. Refer to landing service. because the company is known for its ability to produce lawn furniture more efficiently than any other company in the world, the company must have a(n) ____ advantage. If the mass of an object increases, the force acting on it, such as gravitational force, also increases. A manufacturer wants to implement a trade sales promotion. Which of the following would apply?A. Offering retail stores a 10% discount on their productsB. Offering mail-in rebates to consumers who purchase their productsC. Distributing coupons through newspapers for "buy one get one free" offers on their productsD. Purchasing television ads that promote the enhanced style of their products why did the catholic church feel threatened by the heliocentric theory of the universe A subway ride for a student costs $1.25. A monthly pass costs $35.Write an inequality that represents the number of times, x , you must ride the subway for the monthly pass to be a better deal. 10 lb____64 oz (equal to, greater than, less than) What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer Steam Workshop Downloader