what are the names of four
coplanar points

Answers

Answer 1
Hope this helps a little honey


Related Questions

1. 4^2+25
2.55−4⋅5+12

Answers

For the first one here is my work:

16 + 25
41


For the second one here is my work

62.5 

(The bold numbers are the answers)

Kendra has a math test every 12 school days in a vocabulary test every 9 school days. She has both a math test and a vocabulary test today. When will she have both a math and a vocabulary test again?

Answers

Hi there!
36 school days. You need to find the least common multiple(LMC) the least common multiple of 12 and 9 is 36.
Hope this helps.

0.06 is 10 times as much as

Answers

0.060 is the answer if you're wondering

7 berries are 5 less than twice the number of berries Mickey had for lunch.

Answers

Final answer:

The subject of this question is Mathematics.

Explanation:

To define the subject of the question, we can see that it involves a mathematical problem. The question asks about the relationship between the number of berries a student has and the number of berries Mickey had for lunch. Therefore, the subject of this question is Mathematics.

7 berries are 5 less than twice the number of berries Mickey had for lunch can be represented as 7 = 2m - 5. Therefore, the correct option is c.

The problem states: "7 berries are 5 less than twice the number of berries Mickey had for lunch."

Let's represent the number of berries Mickey had for lunch as 'm'.

Now, translate the problem into an equation based on the information given:

"7 berries are 5 less than twice the number of berries Mickey had for lunch."

Twice the number of berries Mickey had for lunch is 2 times 'm', which is 2m.

"5 less than twice the number of berries Mickey had for lunch" means subtracting 5 from twice the number, so it's 2m - 5.

And finally, the equation becomes:

7 = 2m - 5

So, the correct representation of the situation in an equation is option C: [tex]$7 = 2m - 5$[/tex].

The complete question is given below:
7 berries are 5 less than twice the number of berries Mickey had for lunch. Choose the correct linear equation.

A. [tex]$7=5-2 m$[/tex]

C. [tex]$7=2 m-5$[/tex]

B. [tex]$5=2 m-7$[/tex]

D. [tex]$12=\frac{m}{2}$[/tex]

Can someone help me solve X please?

Answers

6x+34 = 8x+14
2x = 20
x = 10

hope it helps

opposite angle equal each other so you have:

6x+34 = 8x +14

subtract 14 from each side:

6x+20  = 8x

subtract 6x from each side

20 =2x

divide both sides by 2

x = 20/2

x = 10

weight varies directly with gravity a Mars Lander Wade 767 pounds on Earth but only 291 lb on Mars the accompanying Mars Rover weigh 155 lb on Mars how how much did it weigh on Earth round your answer to the nearest pound

Answers

You need to be more specific.

Pls help hurry *Math* will give crown to best answer pls explain!

Answers

Its going to be B, a+14
Collect like terms
13a^2-12a^2-a^2-17a+12a+6a+14
Solve
a^2 is cancelled out (13-12-1=0)
12a+6a=18a-17a=1a
Bring the 14
The answer is a+14
j agree with the answer above

which is both a real number and an integer

The square root of 7
0.15
-15
1/3

Answers

The answer to this question is C. -15
-15
Integers include all whole numbers. And all of those options are real numbers

Solve for v . 3 /9= v/ 12

Answers

Cross multiply. So
12x3=9x
36=9x
x=4
(If you want to check, both fractions simplify to 1/3)

help me solve this equation! and please tell me how you did it step by step, please!!!

-3(2u+5)+3.5u=-1u

a.u=10
b.u=-10
c.u=4
d.u=-4


Please don't plug in the numbers! I'm really confused and I need help on how I could solve this step by step.

Answers

I got you!
First distribute.
-6u-15+3.5u=-1u
Add like terms
-2.5u-15=-1u
Get the u’s on one side and the regular number on the other
-1.5u=15
Divide
U=-10

Consider the two functions which statement is true

Answers

The answer would be the last one because function one has a slope of 1/2 (use rise/run) and function 2 has a slope of 2 (subtract the 2nd y value by the one above it)

The slope of the line in the graph is 1/2, and for the table the slope is 2.

Which is true about the two functions?

We can se two linear functions, remember that if a line passes through two points (x₁, y₁) and (x₂, y₂), then the slope of the line is given by the formula:

a = (y₂ - y₁)/(x₂ - x₁)

For the first line we can see it passes through (-4, 0) and (0, 2), then the slope is.

a = (2 - 0)/(0 + 4) = 1/2

For line b we can use the first two pairs in the table (2, 3) and (3, 5)

So the slope is:

a = (5 - 3)/(3 - 2) = 2

These are the slopes of the lines.

Learn more about slopes:

https://brainly.com/question/3493733

#SPJ3

1. In the middle of the page, draw two circles an inch apart.
2. Draw a slight arch going up from the right edge of the left circle to the left edge of the right circle.
3. Draw a diagonal line out from the left edge of the left circle. This line should go up.
4. Draw a diagonal line out from the right edge of the right circle so that it is parallel to the line just drawn from the left circle.
Which of the following does your image most resemble?
Exit Test
A a can
B glasses
C a car
D a vase

Answers

The answer is b, glasses

Factor 81 – 27p..........................................................

Answers

In order to factor the equation we must first find the highest number divisible by both 81 and 27p. In this case both 81 and 27 are divisible by 27. Once you take 27 from both 81 and 27p you are left with (27)(3-p)...................

At midnight, the temperature was 31.2°F. In the morning, the temperature was −6.7°F. Which statement describes the temperatures?
A. At midnight, the temperature was 31.2 degrees above 0, and in the morning, it was 6.7 degrees lower.
B.At midnight, the temperature was 31.2 degrees below 0, and in the morning, it was 6.7 degrees higher.
C. At midnight, the temperature was 31.2 degrees above 0, and in the morning, it was 6.7 degrees below 0.
D At midnight, the temperature was 31.2 degrees below 0, and in the morning, it was 6.7 degrees above 0.

Answers

C. At midnight, the temperature was 31.2 degrees above 0, and in the morning, it was 6.7 degrees below 0.

35 points please help me i will make you the brainliest

Answers

Hey You!

The images are blurry and I cannot make out most of the questions. I'll solve as many as I can see!

27. ANSWER:

Students A and D have a combined score of 0 because 4 + -4 = 0
___________________

28. SOLUTION/ANSWER:

STEP 1: 12.40 - 0.72 = 11.68

STEP 2: 11.68/2 = 5.84

Answer: Each souvenir cost $5.84.
___________________

29. SOLUTION/ANSWER:

(-68) - 214 = -282

Answer: The lowest elevation in California is -282 feet.

___________________

33. SOLUTION/ANSWER:

60/3 = 20

Answer: The diver's change in depth was -20 per min.

___________________

34. SOLUTION/ANSWER:

-43 - (-34) = -9. The difference between the two is -9.

___________________

35. SOLUTION/ANSWER:

-64.4 + (3.22) = -67.62

Answer: Equals -67.62

___________________

37. SOLUTION/ANSWER:

3.375 = 3 3/8 as a mixed number and 27/8 as an improper fraction.

Answer: 3 3/8 (or 27/8).

___________________

38. SOLUTION/ANSWER:

3 ÷ 5 = 0.6

5 + 0.6 = 5.6

Answer: 5 3/5 = 5.6

____________________

39. SOLUTION/ANSWER:

1.5 + 2.8 = 4.3

Haley jogged 4.3 km that day.

_____________________

I cannot see the other questions. If you can perhaps message them to me I can try to help you! :)

Answer:

100 7774 488

Step-by-step explanation:

There you go! lol

Which set of ordered pairs represents a function? Question 1 options: {(0, 0), (2, 3), (1, -4), (2, -2)} {(5, 6), (2, 6), (-3, 4), (-1, 4)} {(-5, 1), (-4, 2), (-5, 3), (-4, 4)} {(3, -2), (-4, -1), (0, 3), (0, 5)}

Answers

The second option because there isn't the same domain in every other one there is 2 of the same first numbers in the pairs

On a circle graph, a section with an angle measuring 180 represents A:18%, B:50%, C:90% of the whole.

Answers

B; 50% because the whole circle measures 360, and 180 is half of 360 (180+180 =360)

Find the slope of a line through (-1,1) and (0,4)

Answers

Use the slope formula.

m = slope = (y2 - y1)/(x2 - x1)

m = (4 - 1)/(0 - (-1)) = 3/1 = 3

a+b-c=180 solve for a

Answers

a + b - c = 180

a + b - c (+c) = 180 (+c)

a + b (-b) = 180 + c (-b)

a = 180 + c - b

hope this helps

3. Susan invested $10,000 in an account that earned 3% interest, compounded monthly.
a. Write an exponential growth/decay formula to model the situation.
b. What is the value of this account after 5 years? Express your answer rounded to the nearest cent.

Answers

A) total = 10,000 *(1+0.03/12)^(12*t)


B) t = 5 years

10,000 *(1+0.03/12)^(12*5 ) = $11,616.17


The value of Susan's account after 5 years, compounding monthly with a 3% interest rate, is approximately $11,593.74.

To model the situation, we can use the formula for Compound Interest: A = P(1+r/n)^(nt), where A is the amount after time t, P is the principal amount, r is the interest rate, n is the number of times interest is compounded per time period, and t is the time in years.

In this case, P = $10,000, r = 3% or 0.03, n = 12 (compounded monthly), and t = 5.

Substituting these values into the formula, we get:

A = $10,000(1+0.03/12)^(12*5)

Calculating this expression gives us an amount of approximately $11,593.74 after 5 years.

Rounded to the nearest cent, the value of the account is $11,593.74.

Learn more about Compound Interest here:

https://brainly.com/question/14295570

#SPJ6

Is 4 to 7 the same as 7 to 4 when explaining ratios. And why or not.

Answers

Ratio shows the quantity of the relative 2 or more values. No, it would not be the same. The following example will answer your doubt:

There are 500 students in a class. 400 of them are girls, and 100 of them are boys. What is the ratio of girls to boys?

The are asking the quantity of GIRLS to BOYS, means that you will be writing the ratio of girls, and then the boys. If you write the other way around, it would be incorrect because you are not writing the answer as the question says. The ratio of girls to boys is [tex]400:500[/tex] after simplified it is [tex] \frac{4}{5} [/tex]

Hope this helps you!

Have a great day!

12 oz for $1.39 or 14 oz for $1.49

Answers

The shared variance is (coefficient of determination) is .36.

The ratio of pens to pencils in Mrs. Bosworth's desk is 4:1. What does this mean?

Answers

pens : pencils = 4 : 1

This means that for every 4 pens there is 1 pencil.  Another way to say that is that there are 4 times as many pens as pencils.

here are 8 hamsters at Crazy Pete's Pet Shop that are completely brown. The rest of the hamsters at the shop are mixed colors. The 8 brown hamsters represent 25 2/5 of the total number of hamsters at the pet shop. Write and solve an equation, using the variable h, to find the total number of hamsters at the pet shop.

Answers

If the total number of hamsters is h, then h * 2/5 = 8. This means that h= 8 * 5/2 = 20 hamsters in total.


Zoe's pizza costs 12.99. She gave a tip of $2.00. What percent did Zoe leave as a tip?

Answers

You divide 2.00 by 12.99 which is approx. 0.15. you multiply to turn it into a percentage which will be 15%


15% is the answer to the question

determine the percent of the change in the cost of gasoline from 1970 to 2010 round to the nearest whole percent if necessary

Answers

Since the 2010 price is greater ($2.95) than the 1970 price ($1.30) this is a percent of increased. 
Step 1: Find the amount of increased.
Step 2: Find the percent of increased.

The cost of gasoline increased by about 127% from 1970 to 2010.

a school bought 831 boxes of computer paper for the computer lab. Each box has 59 sheets of paper inside it. how many sheets of paper were bought in total?

Answers

 831 *59=49,029

hope this helps!
Hey there!

All you have to do is simply multiply!

831*59= 49,029

49,029 total sheets of paper were bought

40 POINTS ;Find the sum of -2 and -5. Then, in two or more complete sentences, explain the steps you used to add the mixed numbers.

Answers

The sum of -2 and -5 is -7.

I found the sum of -2 and -5 by subtracting the two numbers. Since both numbers are negative, the equation would be set up as -2-5. This is like solving 5+2 which is 7, but just add the negative sign in front of the answer.

Answer:

-5 - -2 would be -3 :)

Step-by-step explanation:

Its negative because 2 is less than 5, so you cant take 5 out of it.

Write the difference 57 – (–38) as a sum. Then simplify.

Answers

the answer is 95 because when you have two negative you add
When you have a negative minus a positive you add
57-(-38)=
57+38=
=95

Hope this helps

A family of four want to go to Cat Island.But their boat only can fit two individuals if they are BOTH children. How do all four people get to the island in the smallest amount of trips?

Answers

im not sure but maybe 1 adult and one child but im not sure if this is a trick question

The boat can fit two children at one time but not two  adults. Then we have the issue of it not specifying if they are all adults or two adults and two children or 1 adult with three children.  so solution have a child and adult go together. with a child in the adults lap. while it is not safe it is possible (warning this is a answer that could irritate any teacher with sense) or presuming this is a family of two adults ad two children, send the two children first together then send the adults separate 3 trips in total 
Other Questions
John Adams Alien and Sedition Acts influenced the election of 1800 because can someone plz help me. Which of the following best describes the Battle of Britain? A. The bombardment of northern France to prepare for a British invasion of continental Europe B. The German sea landing on the southern coast of Britain C. An air battle above the English Channel to prepare for an invasion of Britain D. The sea battle between German U-boats and British battleships Why did the united states get involved in the korean war? what was the outcome of the war? By establishing this link between the levels of cooperation observed in _____ with local forest conditions, rustagi et al. have increased the confidence that scholars can have in the external validity of results from previous experiments carried out all over the world, with student and nonstudent subjects. Refer to landing service. because the company is known for its ability to produce lawn furniture more efficiently than any other company in the world, the company must have a(n) ____ advantage. If the mass of an object increases, the force acting on it, such as gravitational force, also increases. A manufacturer wants to implement a trade sales promotion. Which of the following would apply?A. Offering retail stores a 10% discount on their productsB. Offering mail-in rebates to consumers who purchase their productsC. Distributing coupons through newspapers for "buy one get one free" offers on their productsD. Purchasing television ads that promote the enhanced style of their products why did the catholic church feel threatened by the heliocentric theory of the universe A subway ride for a student costs $1.25. A monthly pass costs $35.Write an inequality that represents the number of times, x , you must ride the subway for the monthly pass to be a better deal. 10 lb____64 oz (equal to, greater than, less than) What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer Steam Workshop Downloader