The thermosphere is the hottest layer because it

Answers

Answer 1

Answer:

because there is not a lot of anything in that layer so anything that comes into it creates a reaction, heat

Explanation:

Because there are relatively few molecules and atoms in the thermosphere, even absorbing small amounts of solar energy can significantly increase the air temperature, making the thermosphere the hottest layer in the atmosphere"


Related Questions

The Serengeti plains are part of the African savanna ecosystem and are home to a variety of different species of plants and animals. The Serengeti plains experience a seven-month period of seasonal drought each year, during which the ecosystem receives only four inches of rain and the availability of some resources becomes very scarce. Which type of limiting factors does the seasonal drought in the Serengeti plains affect?

Answers

Answer:

Water is the limiting factor that the Serengeti plains affect.

Explanation:

From the explanation, Serengeti plains experience a seven-month drought during which only 4 inches of rain is received.

This is a limiting factor that maimes the growth and spread of organisms across the plain.

Due to less amounts of rainfall, there shall be minimal growth of vegetation, this in turn shall lead to loess supply of food for organisms and hence higher mortality rate and low birth rate.

Answer:

density- independent factors

Explanation:

Anyone can help to explain this: Many people (even health professionals) tend to think that overweight people can never be malnourished because they are healthy.

Answers

Well, I don't believe that you can be overweight and healthy unless it is muscle mass that makes you "overweight". Many overweight people actually are malnourished because they are likely eating unhealthy processed food such as fast food. When you eat this constantly, you are depriving your body of essential vitamins and nutrients. These nutrients and vitamins are essential for building muscle mass, so is exercise. If you are overweight, you are probably not exercising like you should. Unhealthy food choices, low muscle mass, and lack of exercise can dramatically lower one's metabolism. If your metabolism is slow, it takes longer for your body to take in the needed nutrients and vitamins.

How is a scientific law different from a scientific theory?

A. A theory becomes a law after a long period of time has passed.

B. theory is why something happens and a law is how something happens.

C. A theory cannot be disproved but a law can be disproved.

D. A theory is used for biology and chemistry and a law is used for physics.

Answers

Final answer:

A scientific law is a concise statement that describes a pattern or behavior in nature, while a scientific theory is a more complex and dynamic explanation of a group of related phenomena.

Explanation:

A scientific law is a concise statement that describes a pattern or behavior in nature that is supported by evidence and repeated experiments. Laws are often expressed in the form of a single mathematical equation. On the other hand, a scientific theory is a more complex and dynamic explanation of a group of related phenomena. Theories attempt to explain why nature behaves the way it does, while laws describe what happens.

Final answer:

A scientific law describes how something happens using a concise pattern in nature, often expressed as a mathematical equation, like F = ma for Newton's second law of motion. A scientific theory is a more complex explanation of why phenomena occur, such as the Theory of Evolution or the Theory of Relativity, and evolves over time as new evidence is found.

Explanation:

The question on how a scientific law is different from a scientific theory can be best answered by choice B: A theory explains why something happens and a law describes how something happens. A scientific law uses concise language to express a generalized pattern observed in nature, often supported by significant scientific evidence and can be demonstrated through repeated experiments. Laws can typically be distilled into mathematical equations or principles. An example is Newton's second law of motion, represented by the equation F = ma, which describes the relationship between force, mass, and acceleration.

On the other hand, a scientific theory is more complex and dynamic, providing an overarching explanation for a group of related phenomena based on a body of evidence. Theories, such as the Theory of Evolution or the Theory of Relativity, are comprehensive and explain why things occur as they do in nature. They are not concise enough to be summarized into a single equation or statement. Unlike a law, a theory does not transform into a law over time; they continue to evolve as new evidence emerges.

A pure substance has a/an _______ composition.
A/An _______ is composed of two or more types of matter that can be present in varying amounts.
A solution is a/an _______ mixture.
A mixture that is not uniform throughout is a/an _______ mixture.
A pure substance that cannot be broken down chemically is a/an _______.
A characteristic of matter that’s not associated with a change in its chemical composition is known as a/an _______ property.
Wax melting is an example of a/an _______ change in the state of matter.
A banana peel turning brown is an example of a/an _______ change in the state of matter.

Answers

Answer:

constant

mixture

homogeneous

heterogeneous

element

physical

physical

chemical

Explanation:

A good answer should contain the following:

got this from penn foster

A pure substance has a/an constant composition. A  pure substance is defined as the substance that has a fixed chemical composition throughout such as water, nitrogen and air.

A/An mixture  is composed of two or more types of matter that can be present in varying amounts. A mixture is composed of one or more pure substances in varying composition.

A solution is a/an homogeneous mixture.

A mixture that is not uniform throughout is a/an heterogeneous mixture.

A pure substance that cannot be broken down chemically is a/an element.

A characteristic of matter that’s not associated with a change in its chemical composition is known as a/an physical property.

Wax melting is an example of a/an physical change in the state of matter.

A banana peel turning brown is an example of a/an chemical change in the state of matter.

For more details regarding physical and chemical property of matter, visit:

https://brainly.com/question/13339068

#SPJ2

Why was T.Rex able to see the insurance broker in the bathroom

Answers

Answer: Because it was tall?

Explanation:

An infected mosquito may potentially bite a person with untreated or inadequately treated malaria. These disease-carrying mosquitoes can transfer the sickness to others by biting and infecting healthy people. Direct human-to-human transmission of malaria is not possible.

What plasmodium cause disease to healthy individual?

Rhonaldros was tackling a challenge. A healthy individual couldn't be bitten by musketoe because of the sickness. He was able to recognize particular species of human-biting scio females and Avillus moscleto.

Infectious stages of the plasmodium are transmitted to the individual who was bitten by the mosquito when it was carrying plasmodium. When a healthy individual contracts malaria, this is used to treat the transmontane form of the disease. The truth is that musquetoe can spread malaria to a healthy individual. The moschitoeon was not bitten by the rans.

Therefore, T.Rex, able to see the insurance broker in the bathroom.

Learn more about plasmodium here:

https://brainly.com/question/7624790

#SPJ2

Which of the following is not true of most sex-linked traits?

A. Located on the X chromosome
B. Located on the autosomes
C. Usually recessive
D. Usually seen in males

Answers

Answer:

a

Explanation:

Final answer:

Sex-linked traits refer to those associated with genes located on sex chromosomes. They are typically recessive and more common in males. The statement that these traits are located on autosomes, which are non-sex chromosomes, is incorrect.

Explanation:

In studying genetics, we learn that sex-linked traits are primarily associated with genes located on sex chromosomes. These traits, more often than not, are recessive and more common in males, as they carry only one X chromosome and, therefore, express all traits that are linked to this chromosome.

Yet, the statement that sex-linked traits are located on autosomes is not true. Autosomes are all the other chromosomes that are not sex chromosomes. Hence, the answer to your question is option B: Sex-linked traits are not located on the autosomes.

Learn more about Sex-linked Traits here:

https://brainly.com/question/1381309

#SPJ3

There are several problems with classifying organisms into six kingdoms of life. One problem is that _______ aren't well defined and are very diverse. In addition, any eukaryotes that don't fit into other kingdoms are placed in this kingdom. A. fungi B. plants C. archaea D. protists

Answers

Answer:

D. Protists

Explanation:

Kingdom protista is composed of mostly unicellular organisms, but they do include some multicellular organisms. Like your problem says, eukaryotes that do not fit in other kingdoms are placed in this kingdom. As a result, even members of this kingdom do not share many similarities, as the organisms here are diverse.

The answer is D. Protists

Which part of a sperm cell is responsible for providing the cell's energy?

A.
round head

B.
mitochondria section

C.
flagellum

D.
cell wall

Answers

B. The mitochondria section stores all the cells energy

helped needed asap! urgent

Answers

Answer:

the answer is parasitism

Explanation:

the parasite benefits by taking nutrients, and the other is losing it.

Answer:

The answer is Parasitism

need help asap!!!
Sound waves travel down the ear canal and strike the _____, causing it to vibrate and to pass the vibrations on to small bones in the middle ear.

(A)eardrum
(B)anvil
(C)stirrup
(D)cochlea

Answers

Answer:

(A) eardrum

Explanation:

A. Eardrum

Explanation: Sound waves enter the outer ear and travel through a narrow passageway called the ear canal, which leads to the eardrum. The eardrum vibrates from the incoming sound waves and sends these vibrations to three tiny bones in the middle ear.

Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.

Answers

Answer:

C. It is caused by a virus, not a bacterium

Explanation:

The answer is C influenza is caused by viruses not a bacterium

viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood

The history of Taurus

Answers

Answer:

The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle. The sign of Aries represents the beginning of spring and with it the beginning of life, while Taurus is a fixed sign that continues what Aries has started. Life is in full bloom in the sign of Taurus.

The stars in Taurus constellation host two open clusters, the Pleiades and the Hyades and are mostly located at the end of the sign of Taurus and the beginning of the zodiacal sign of Gemini. In the Early Bronze Age it marked the location of the Sun during the spring equinox, just like the constellation of Aries represented the equinox over 2000 years ago. The constellation of Taurus was linked to it 5000 to 1700 BC, before the precession of the equinox moved our perspective to the sign of Aries.

Answer:

The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle.

Explanation:

A population of 20 monarch butterflies colonizes a meadow. The meadow's carrying capacity for monarch butterflies is 5,000 individuals. What statement best describes the growth of the population of monarch butterflies after the meadow is colonized?
A.
The population grows at a constant rate until it approaches 5,000 individuals, and then its growth rate increases.
B.
The population grows exponentially until it approaches 5,000 individuals, and then the population size begins to decrease.
C.
The population grows exponentially until it approaches 5,000 individuals, and then its growth rate decreases.
D.
The population grows at a constant rate until it approaches 5,000 individuals, and then the population size remains stable.

Answers

Answer:

The only possible answer is D, which states that the population will reach 5000 and after that the growth will stabilise (exactly what would hapen in a logistic growth).

Hope This Helps!  Have A Nice Day!!

Answer:

The correct answer is option D, that is, the population grows at a constant rate until it approaches 5,000 individuals, and then the population size remains stable.

Explanation:

The maximum capacity of the monarch butterfly, which can thrive in the meadow is 5000, which signifies that the population of twenty butterflies will continue to grow unless and until it attains the population of 5000.  

In case if the growth of the population takes place exponentially, then there would be an end and the limit of 5000 would not have any significance. However, if the growth of the population takes place logistically, then the end of the growth would be the same as the limit that signifies that the 5000 limits would exhibit significance.  

Thus, the only probable answer would be option D, that is, the population will attain 5000 mark and post that the growth will become stable, which precisely takes place in a logistic growth.  

What happens when an electrical gradient and a chemical gradient are applying opposite forces to active transport?

Answers

Answer:

Active transport utilises a carrier transport protein molecule that hydrophilic pathway is specific to allow molecules to pass through one directional. Hence, nothing happens to active transport.

Answer:

The active transport keeps the ion balance across the membranes.

Explanation:

The active transport needs both gradients to work one against each other to move the ions across the membranes, that means opposite forces will keep the active transport working.

Nitrogen oxide is released when _____. hydrocarbons combine with water plants make food through photosynthesis special bacteria break down nitrogen fuels are burned at high temperatures

Answers

Answer:

Nitrogen fuels are burned at high temperatures

Explanation:

When the nitrogen-based fuel is burned at high temperatures, the nitrogen in the fuel combines with oxygen to form nitrogen oxide. While this can occur n combustion engines in cars, leading to pollution, the same occurs naturally espically during lightning strikes that cause the nitrogen gas in the atmosphere combine with oxygen. NO is an airway irritant.

Answer:

it´s D I got it correct

Why did Isaac Newton conclude the universe was static? Was he correct?

Answers

He thought the ‘stuff’ (celestial  bodies) in the universe that had mass attracted each other through the force of gravity. Therefore even the bodies at the edge of the universe would be attracted by gravity by the bodies inside the universe preventign them from moving further outward.

He was wrong, however, because it has been discovered, using Doppler shift effect, that the universe is actually expanding.

Why is carbon dioxide considered a greenhouse gas? (A) It is released when fossil fuels are burned. (B) It is part of the carbon cycle, which is also known as the greenhouse cycle. (C) It can absorb infrared radiation. (D) It is responsible for protecting organisms from UV radiation.

Answers

Answer:

C It can absorb infrared radiation

Explanation:

How do invasive species disrupt an ecosystem? Describe at least one example of when invasive species have disrupted an ecosystem. Your example could be a plant, animal, fungus, ext. (please please please help!!)

Answers

Answer:

Explanation:

I think one of the most invasive species is perhaps the Dandelion. Who hasn't had a fit when we see them change from yellow to gray. The yellow is pretty, but the gray means it is ready to spread its seed to create more trouble.

Dandelions can be killed with herbicides, but I think you'd be as well off putting up with the dandelion. The herbicides have an unproven effect on our health.

The dandelion was introduced into the Americas in the mid 1600s and was used as food and had medical properties. Since then, because it has no common enemy in nature, it has spread the entire width of the continent. Rather amazing, I think.

When a new aggressive species is introduced into an ecosystem, it may not have any natural predators or controls. They can breed quickly and take over an area and native wildlife may not have evolved defenses against the invader. The invader also takes over the natural resources for the native species. Aggressive plant species like Kudzu can quickly replace a diverse ecosystem with a monoculture of just Kudzu. Additionally, some invasive species are capable of changing the conditions of an ecosystem, such as changing soil chemistry or the intensity of wildfires.

What evidence makes scientists think that land plants evolved from green algae

Answers

Answer:

Because the algea was not strong enough yet to live on its own and had to stay close a water source, where it could get water and sunlight without doing any work.

Explanation:

Final answer:

Scientists believe that land plants evolved from green algae due to shared physical traits, biochemical pathways, and their common monophyletic heritage. These include similar mechanisms of cell division, storage of starch, the presence of chlorophyll as a photosynthetic pigment, and being part of the same photosynthetic lineage, the Archaeplastida.

Explanation:

The evidence that leads scientists to believe that land plants evolved from green algae is rooted in various shared characteristics and evolutionary lineage. Green algae, especially the Charophytes, share several traits with land plants, such as having chlorophyll a and b as photosynthetic pigments, cellulose cell walls and starch as a storage molecule. Another crucial point to note is a common mechanism of cell division and significant biochemical pathways.

Furthermore, evolutionary thought indicates that all plants, including green algae and land plants, are monophyletic, meaning they descend from a common ancestor. The transition from water to land posed significant challenges to plants in the form of avoiding drying out, spreading reproductive cells in air, developing structural support, and capturing sunlight. Characteristics like these were developed during evolution by both green algae and land plants.

Lastly, the Archaeplastida, which includes green algae and land plants, became photosynthetic through an endosymbiotic relationship with a green, photosynthetic bacterium around 1.65 billion years ago. This lineage evolved into what we know today as red and green algae, and eventually land plants such as mosses, ferns, gymnosperms, and angiosperms. These shared traits and the evolutionary history demonstrate the strongly supported theory that land plants evolved from green algae.

Learn more about Evolution of Land Plants here:

https://brainly.com/question/12045339

#SPJ3

A nerve impulse travels from one cell to another by passing
A- one axon to another axon
B- one dentrite to an axon
C- one axon to a dentrite
D- one dentrite to another dentrite

Answers

The answer is C.

The reason why is because when the nerve impulse reaches the axon then moves its way to the bottom where the dentrite is, chemical messengers called neurotransmitters are released.

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence

Answers

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’


Which event would MOST LIKELY speed up the process shown in the diagram?
A) another ice age
B) continental drift
C) a reversal in Earth's magnetic field
D) an increase in atmospheric carbon dioxide

Answers

an increase in atmospheric carbon dioxide

Answer: D

Answer: D) an increase in atmospheric carbon dioxide

Explanation: usatestprep approved

What acts as a source of heat in the mantle and results in mantle convection?

A. Volcanoes
B. The asthenosphere
C. Slab pull
D. Earth's core

Answers

Earth's core acts as a source of heat in the mantle and results in mantle convection.

Answer: Option D

Explanation:

The earth is divided into three layers namely the outer crust, the middle mantle and the inner core. The inner core layer of the earth has very high temperature due to which it is very hot and it acts as source of heat for the middle layer mantle.

Mantle convection is the moderate crawling movement of Earth's strong silicate mantle brought about by convection flows conveying heat from the earth’s core to the earth’s crust. Thus the Earth's core acts as the heat source for mantle.

Final answer:

The heat in the mantle resulting in mantle convection comes from d) Earth's core. This heat causes convection currents that are crucial to the movement of tectonic plates, forming new lithosphere and driving volcanic and geological activity.

Explanation:

The source of heat in the mantle that results in mantle convection is Earth's core. The heat flows outward from Earth's interior, and this transfer of heat from the hot core to the cooler mantle creates convection currents. These convection currents are essential because they act as the primary driving force for the movement of tectonic plates. When these currents move upward in the mantle, new lithosphere is formed, and tectonic plates move apart, a process known as divergence. Conversely, where plates converge, one plate may be subducted beneath the other, which can create trenches and result in volcanic activity.

Important Processes and Locations Influenced by Mantle Convection

Generation of magma at subduction zones due to flux melting, where the addition of volatiles lowers the melting point of mantle material.

Formation of new crust at mid-ocean ridges where seafloor spreading occurs.

Creation of hotspot-generated volcanoes above mantle plumes, which are not associated with any specific plate boundary.

Sunlight-Rose-Honeybee-Skunk-Eagle
study the food chain above. if the population of homeybees had a major increase, which of the following would most likely happen.​

Answers

The rose population would decrease because the bees would need more food. Since the skunk has more food, it would increase and the eagle population would probably increase too because of more access to skunks. The eagle interpretation may be true unless the eagle is perceived as a scavenger. Then the population would most likely stay the same. The sun would stay the same because it is an abiotic factor in an ecosystem. your welcome fam

Sunlight is the same (obvs) then roses decrease because there are more honeybees to eat them. Skunks would probably increase bc there are lots more honeybees to eat but then honeybees decrease probably. Eagles increase cos skunks increased after honeybees increased. Basically sunlight stays same, roses dercrease and the rest increase.

Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology

Answers

Answer:taxonomy

Explanation:

Modern Taxonomy

Carolus Linnaeus it credited with developing the scientific naming and classification system.

Hope this helps!!

At which region of a state's geology would an earthquake be more likely?



Near a divergent boundary of two plates


At the site of geologic uplift where island chains form


At the site of a convergent boundary as plates move together


Around a transform boundary between two plates that slide past each other

Answers

Answer:

Around a transform boundary between two plates that slide past each other

Explanation:

Which part of a mushroom can you see above the ground?

Answers

Answer:

The correct answer is reproductive part.

Explanation:

The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.

How does the biological species concept identify two different species?
A. reproductive isolation
B. asexual reproduction
C. interaction between two species
D. the difference in the way of life

Answers

Answer:

D or C

Explanation:

just for the heck of it

Answer:

i think the answer is C.

Hope it helps

Explanation:

**WILL MARK BRAINLIEST AND THANK YOU**

Forensic Science

Which information is necessary to determine the speed of a vehicle in an accident?

A. Distance between tires and length of the skidmarks

B. Length of skid marks and type of pavement

C. Length of skidmarks, type of pavement, and wet or dry conditions

D. Length of skidmarks alone

Answers

Answer:

The correct answer is C; Length of skidmarks, type of pavement, and wet or dry conditions

Answer:

Explanation:

c

The information contained in the table could be used _______________________.

Answers

Can you attach the table so I can see it??

Answer:

A

Explanation:

to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.

Other Questions
What was the first u.S. State to pass speed limit laws? Which option is a characteristic of an unreliable narrator? intends to deceive others does not intend to deceive others deceives others, whether intentionally or unintentionally recounts events in a distant narrative style find the complex cube roots of 8(cos(4pi/5)+isin(4pi/5)) What is the median of the data set?3,10,1, 6, 10,3,11,14 PPLLLZZ HELP!!!!the characteristics of certain cell divisions are described in the following table which type of cell division do the two characteristics represent??? characteristic 1 forms diploid cellscharacteristic 2 creates sex cells or gametes A those characteristics represent meiosis.B both characteristics represent mitosis.C characteristic 1 represents meiosis and characteristic 2 represents mitosis.D characteristic 1 represents in mitosis and characteristic 2 represents meiosis. Drug abuse is defined as __________. A. the consumption of legal drugs for medical purposes B. the consumption of illegal drugs for medical purposes C. the nonmedical or improper use of a drug, which can interfere with a healthy life D. using drugs on an occasional basis until mood is altered Cameron as listing reasons to support his claim that restoring the historical town library is better than tearing it down which reason would be best to include in his argumentative essay Jenny bought a new car for $25,995. The value of the car depreciates by 16 percent each year. Which type of function could model the value of the car? A. Exponential B. Can't be determined C. Linear D. Quadratic A friend asks you how much pressure is in your car tires. You know that the tire manufacturer recommends 30 psi, but it's been a while since you've checked. You can't find a tire gauge in the car, but you do find the owner's manual and a ruler. Fortunately, you've just finished taking physics, so you tell your friend, "I don't know, but I can figure it out." From the owner's manual you find that the car's mass is 1000 kg . It seems reasonable to assume that each tire supports one-fourth of the weight. With the ruler you find that the tires are 13 cm wide and the flattened segment of the tire in contact with the road is 13 cm long. 2 PointsWhat example does Alan Weisman give to show that nature has little concern!for things that humans find important?!OA. Squirrels in the BronxOB. Clothing in department storesOC. Money in bank vaultsOD. Coyotes in Central Park How would the Suez and Panama Canal lead to power and wealth? PLEASE BE A KIND HUMAN AND HELP ME PLEASE ITS URGENT im freaking outPLEASE BE A KIND HUMAN AND HELP ME PLEASE ITS URGENT:There is a small village in a mountain valley in Spain whereumnumber of people are polydactyl (have more than five fingers or toes).oneWhy does this trait tend to be passed on from generation to generation? A bag contains different colored candies. There are 50 candies in the bag, 28 are red, 10 are blue, 8 are green and 4 are yellow. What is the probability of choosing five pieces of candy and getting 2 red and 3 green? 3. Complete the square for 3x2 - 6x = 21.Help f(x) = x 2+ 6 and g(x) = 2x - 1g[f(x)] = Lizzie loves to stargaze at night. She has noticed that the moon appears to change shape over the course of the month, and she wants to investigate why this happens. She hypothesizes that the relationship of the sun, Earth, and moon creates shadows on the moon. She sets up an experiment with a lightbulb to represent the sun, a large beach ball to represent Earth, and a smaller foam ball to represent the moon. She researches the position of the sun, Earth, and moon at different times of a month and makes a model of the entire system. 1. Identify the parts of the scientific method in Lizzie's experiment. 2. List at least three variables Lizzie should control during the experiment. For each variable identified, give a specific suggestion for how Lizzie can control it. Solve for the roots in the equation below. x^4+3x^2-4=0 Excerpt from Energy from the WindLi Yung1Every year, more people are looking to get energy from the wind. Wind is a clean, renewable source of energy. Renewable sources of energy come from natural resources that will not run out, such as sunlight, wind, and water. Renewable energy is also called clean energy because it does not dirty, or pollute, the air or water.2We need to use renewable energy sources to keep our world healthy. One problem facing our world is global warming, a rise in the earths temperature. Global warming is likely caused by pollution created when people use fossil fuels such as natural gas and coal. Fossil fuels give us energy, but they create pollution and they cannot be renewed. That means that once people have used them, they cannot be replaced. Wind energy, on the other hand, does not pollute and will never be used up. What sort of evidence does Li Yung use in this passage to support his claim that wind power is a good investment for energy production in the future?A)The author, Li Yung, does not provide any evidence to support his argument's claims.B)The author primarily provides anecdotal evidence, using stories from his life for support.C)The author use empirical data, numbers and statistics to provide support for his argument's claims.D)The author use logical, rational evidence, describing the benefits of utilizing wind power for energy. What does water pollution cause? Water pollution ------- causing has a prominent harmful effect on aquatic environments. Today Charlie and Sophie are exploring the Costa Rican jungle.TrueFalse Steam Workshop Downloader