The outside temperature was 73°f at 1.p.m and decreases at a rate of 1.5°f each hour. What expression can be used to determine the temperature h(h is the variable) hours after 1.p.m?

Answers

Answer 1
Your expression will be h = -1.5°x + 73°
Answer 2
Final answer:

The expression to represent the temperature 'h' hours after 1 p.m. given an initial temperature of 73°F and a decrease rate of 1.5°F per hour is 73 - 1.5h. This allows us to calculate the temperature at any given hour where 'h' is the number of hours after 1 p.m.

Explanation:

The problem involves dealing with linear equations, specifically those representing changes over time. In this situation, the temperature starts at 73°F at beginning of the time, i.e., at 1 pm and then decreases at a steady rate of 1.5°F per hour.

So, the decrease in temperature can be represented by 1.5h, where h is the number of hours elapsed since 1 p.m. As the temperature starts at 73°f, we subtract this decrease from the initial temperature. Therefore, the expression to determine the temperature after h hours is 73 - 1.5h.

This equation tells us that for each hour after 1 p.m., we simply subtract 1.5 from 73 and this would give the temperature at that time. For example, at 2 p.m., h equals 1, and the equation 73 - 1.5(1) gives us 71.5°F.

Learn more about Linear Equations here:

https://brainly.com/question/32634451

#SPJ2


Related Questions

shari’s class is making team pennants for an upcoming field day.they cut the pennants out of a large sheet of paper in the pattern shown below. the area of the whole pattern is 1600 cm2. they need to know the length of the pennant base how long is the base of each pennant

Answers

Answer:

10cm Base

Step-by-step explanation:

Actually the answer is 10 cm for the base.

First step is take 1600cm2 and divide it by 4 (or how many pendents you have) so it'll look like this

1600/4 =400cm2

Then you need to find the area of the Triangles.

Area of the Triangle=1/2xbase xheight

400=1/2xbx80

400=40xb

10=b

Answer: 10cm Base

Step-by-step explanation:

Write two ratios that are equivalent to 5/7

Answers

Ratios equivalent to 5:7

10:14

20:28

30:42

hope this helps :D
25/40 and 10/14 are equivalents to 5/7.

if an obtuse angle is split in half, how can the two new angles be classified? give an example.

Answers

I know one would be acute because its a shape

Splitting an obtuse angle in half will either result in two acute angles or right angles, depending on the original angle's measure.

When an obtuse angle is split in half, each of the two new angles will be either acute or right angles, depending on the measure of the original obtuse angle. An obtuse angle is one that is greater than 90 degrees but less than 180 degrees.

By splitting an obtuse angle exactly in half, both resulting angles will have a measure less than 90 degrees, making them acute, unless the original angle was exactly 180 degrees, in which case the split would result in two angles of 90 degrees each, making them right angles.

Consider the obtuse angle, ABC, which measures 120 degrees. When we bisect angle ABC to create two new angles, namely ABD and DBC, each of these angles will measure 60 degrees, classifying them as acute angles.

The cost y (in dollars) to rent a camping tent is proportional to the number x of days that the tent is rented. It costs $56 to rent a tent for 7 days. Write an equation that represents the cost to rent a camping tent for x days.

Answers

56y=7x might be the equation

Answer:

[tex]y=8x[/tex]

Step-by-step explanation:

we know that

A relationship between two variables, x, and y, represent a proportional variation if it can be expressed in the form [tex]y/x=k[/tex] or [tex]y=kx[/tex]

In this problem the linear equation represent a proportional variation

Let

x------> the number of days

y-----> the cost to rent a camping tent

The linear equation is equal to

[tex]y=kx[/tex]

we know that

It costs [tex]\$56[/tex] to rent a tent for [tex]7[/tex] days

Find the value of k

[tex]56=7k\\ \\k=56/7\\ \\k=8\frac{\$}{day}[/tex]

substitute

The linear equation is equal to

[tex]y=8x[/tex]

Compare and contrast the different battles that took place at: Ticonderoga, Necessity, William Henry, Quebec, Montreal, and Duquesne.

Answers

They all were in the French and Indian war

I WILL GIVE BRAINIEST TO CORRECT ANSWER! All questions please.

Answers

Question 1: 4/25 = 0.16
Question 2: 4 6/25 = 106/25 = 4 6/25 = 4.24
Question 3: 7.8 = 7 8/10 = 7 4/5

hope this helps

how many 6 ounce cups can be filled from 4 gallons of juice?

Answers

1 gallon = 128 oz
128/6= 21.33 cups
4x21.33= 85 cups


BRAINLIEST???

1 gallon = 128 ounces.

4 gallons = 512 ounces.

512/6 = 85.3

So, 85.3 (85) 6 oz cups can be filled with juice from 4 gallons.

I hope this helped! c:

what is 118/13 = 59/z?

Answers

If you're finding the value of z, z would equal 13/2 or 6.5
:)
118/13 =9.0769 = 59/z z= 9.0769x59 = 535.538

What is 7700 divided by 623

Answers

the answer is 12.3595506
       _12____
623| 7700
        -623
        ---------
           1470
          -1246
         -------- 
            224

THIS IS MY LAST ONE BROS.

Mrs. Lamb is going to make a 3 question true false test. She wants to see how many different answer keys would be possible. What could she do to simulate this quiz? What would the sample space be?

Answers

Hello!
Some sample keys for the true or false three question test would be:

 Keys are: False, False, False, True, True, True, False, False, True, True, True, False, False, True, False, True, False, True. False, True, True, True, True, False. Those are all the possible combinations for the answer key. (every 3 is a group).  Hope this helps! Have a great day!

whats the exact value of tan (300°)

Answers

Answer:

[tex]Tan(300^{\circ})= - \sqrt{3}[/tex]

Step-by-step explanation:

Tan (300°) can be written as Tan (360°-60°)   ---1

Using identity :

[tex]Tan(360^{\circ}-\theta)=- Tan\theta[/tex]

Using 1

So, [tex]Tan(360^{\circ}-60^{\circ})= - Tan60^{\circ}[/tex]

The value [tex] Tan60^{\circ}=\sqrt{3}[/tex]

So, [tex]Tan(300^{\circ})= - \sqrt{3}[/tex]

Thus the exact value of    [tex]Tan(300^{\circ})= - \sqrt{3}[/tex]

 

Answer:

[tex]-\sqrt{3}[/tex]     or     Option A on E2020 Quiz

Step-by-step explanation:

Erik bought a savings bond. He could have invested in a mutual fund and earned 2 percent more. The 2 percent he could have earned is the _____.

Answers

The answer to go in the blank would be ''opportunity cost'' since he had the chance to invest in his mutual fund and get two percent more so he could've gotten more money.

Answer:

The 2 percent he could have earned is the opportunity cost.

Step-by-step explanation:

Erik bought a savings bond. He could have invested in a mutual fund and earned 2 percent more.

The 2 percent he could have earned is the opportunity cost.

The opportunity cost is defined as the loss of potential gain from other alternatives when one alternative is chosen.

What is the solution to this equation? 3(d+2)−12=d−2 A)d = 2 B)d = 4 C)d = 8 D)d = 10

Answers

The answer s a)d=2.

Answer: d = 2

Step-by-step explanation:

3(d+2)−12=d−2

Venetta buys 2 pounds of pistachios and 3 pounds of almonds. The pistachios cost $4 more per pound than the almonds. She pays a total of $48. Which of the following are true? Select all that apply.
A. One pound of pistachios plus 1 pound of almonds cost $20.
B. The pistachios cost twice as much per pound as the almonds.
C. Reducing the number of pounds of almonds by one results in a total cost of $40. D. The cost a, in dollars, of 1 pound of almonds is modeled by 2(a – 4) + 3a = 48. E. The cost p, in dollars, of 1 pound of pistachios is modeled by 2p + 3(p – 4) = 48.

Answers

We want to find a system of equations, and by solving that system we will be able to see which statements are true.

We will see that options A, C, and E are true.

We know that:

Venetta buys 2lb of pistachios

Venetta buys 3 lb of almonds.

Let's define the variables:

x = price per pound of pistachios

y = price per pound of almonds.

Now we also know that:

"The pistachios cost $4 more per pound than the almonds."

This can be written as:

[tex]x = y + \$4[/tex]

"She pays a total of $48"

This can be written as:

[tex]2*x + 3*y = \$48.[/tex]

So a system of equations:

[tex]x = y + \$4[/tex]

[tex]2*x + 3*y = \$48.[/tex]

To solve this system, the first thing we need to do is isolate one of the variables in one of the equations, particularly we can see that x is already isolated in the first equation, so we can skip that step.

Now we can replace the isolated variable in the other equation to get:

[tex]2*(y + \$4) + 3*y = \$48[/tex]

now we can solve this for y:

[tex]2*y + \$8 + 3*y = \$48[/tex]

[tex]5*y + \$8 = \$48[/tex]

[tex]5*y = \$48 - \$8 = \$40[/tex]

[tex]y = \$40/5 = \$8[/tex]

now that we know this, we can use:

[tex]x = y + \$4 = \$8 + \$4 = \$12[/tex]

now that we know:

y = $8

x = $12

Let's see which statements are true:

A) One pound of pistachios plus 1 pound of almonds cost $20.

True, $8 + $12 = $20.

B)  The pistachios cost twice as much per pound as the almonds.

False, $12 is not the double of $8.

C) Reducing the number of pounds of almonds by one results in a total cost of $40.

True, one pound less of almonds means $8 less in the price.

D) The cost a, in dollars, of 1 pound of almonds is modeled by 2(a – 4) + 3a = 48

Simplifying the expression we get:

2*(a - 4) + 3a = -8 + a = 48

a = 48 + 8 = 52

This clearly does not model the price of one pound of almonds, this statement is false.

E) The cost p, in dollars, of 1 pound of pistachios is modeled by 2p + 3(p – 4) = 48.

Solving the equation we get:

2*p + 3*p - 12 = 48

5*p = 48 + 12 = 60

p = 60/5 = 12

This is true.

If you want to learn more, you can read:

https://brainly.com/question/20067450

The sum of three integers is 74. The first integer is twice the second and the third is six more than the second. What are the three integers

Answers

let thw second integer be x
then the first = 2x
and the third integer is = 6+x
their sum = 74
x+2x+6+x = 74
4x +6 = 74
4x = 74-6 =68
x =68÷4
x = 17
then the first integer is 2×17 = 34
the third integer is 17+6 = 23

the integers are 17 , 23 and 34

8 is 40 percent of what number

Answers

Answer:

20%

Step-by-step explanation: So 40 percent = 100 percent. If you divide 40 percent by 5 you get 8. 1/5 is equal to 20% and 8 is a fifth of 40. So the answer is 20%.

We have that the 8 is 40 percent of 20 and it  is mathematically given as

x=20

Arithmetic

Question Parameters:

8 is 40 percent of what number

Generally the equation for the statement  is mathematically given as

x*40%=8

Therefore

x*40%=8

x*0.4=8

x=20

For more information on Arithmetic visit

https://brainly.com/question/22568180

A football team receives the ball on their own ten yard line. They make a gain of fifteen yards in the first play. What yard line is the ball on? What represents zero in this situation? Explain

Answers

The ball is on the 25 yard

The summation of 10 yds and fifteen yds is 25 yds thus the ball is the on 25 yd line and the zero represents the ball is in the net and goals.

What is summation?

The summation is to add or subtract any two or more terms by doing that operation we will get a new result which could be big or small depending upon the number.

There could be only two terms, but there could be one hundred, a thousand, or a million.

As per the given question,

The initial position of the ball = 10 yd line

The team gained 15 yds in the first play.

Therefore, New position of the ball = 10 yds + 15yds = 25 yds

Hence "The summation of 10 yds and fifteen yds is 25 yds thus the ball is the on 25 yd line and the zero represents the ball is in the net and goals".

For more information about summation

brainly.com/question/10777222

#SPJ5

A company employs 72 workers. It plans to increase the the number of employees by 6 per month until it has twice its current workforce. How many months will it take to double the number of employees

Answers

First, set up an equation to model the number of employees.
y = mx + b, where m = slope and b = y-int

y = 6n + 72
This means that, for every month, n, 6 more employees will be added to the 72 that the company began with.

To find out how many months it will take to double the amount of employees, use the following equation:
(72 x 2) = 6n + 72
144 = 6n + 72
144 - 72 = 6n
72 = 6n
72 / 6 = n
12 = n
It will take 12 months for the number of employees to double.

15(−22.38−10.12) HELP PLEASE!!!




lots of points

Answers

The answer to this question is -345.82
In a fraction it would be -17291/50
The answer is -487.5

The area of the parallelogram is 45 square miles. Find its base and height

Answers

A parallelogram is a 4-sided shape formed by two pairs of parallel lines. Opposite sides are parellel separately, so each pair of opposite sides have equal lengths and angles. To find the area of a parallelogram, multiply its base by height. The formula is: A(rea) = B(ase) * H(eight) * means multiply. In the question, the area of the parallelogram is known as 45 square miles, which means: 45 = B * H So we need to find out all the possible pair of factors, whose product is 45: 1 * 45 = 45 3 * 15 = 45 5 * 9 = 45 Then we know base and height will fall into each pair: 1 * 45 = 45 => B = 1 miles, H = 45 miles or B = 45 miles, H = 1 miles 3 * 15 = 45 => B = 3 miles, H = 15 miles or B = 15 miles, H = 3 miles 5 * 9 = 45 => B = 5 miles, H = 9 miles or B = 9 miles, H = 5 miles

Final answer:

The student's question involves finding the base and height of a parallelogram given its area. Without additional information, there are infinite base-height combinations possible. The formula used is base multiplied by height equals the area of the parallelogram.

Explanation:

The student is asking about the relationship between the base, the height, and the area of a parallelogram. To find the base and height from the area, the formula for the area of a parallelogram is used, which is base x height = area. With an area of 45 square miles, if we have the measurement of either the base or the height, we can divide the area by that measurement to find the other dimension. However, with only the area given, the base and height can't be uniquely determined; there are infinitely many combinations of base and height that yield the same area. For instance, if the base is 9 miles, the height would be 5 miles, or if the base is 15 miles, the height would be 3 miles, and so on.

the product of 2 consecutive natural numbers is greater than their sum by 109. find the numbers

Answers

Let the 2 consecutive numbers be n and n+1. Then:
n(n+1)-109=n+n+1
n²+n-109-2n-1=0
n²-n-110=0
(n-11)(n+10)=0
n=11
n+1=12
☺☺☺☺

Write 2687 in expanded form

Answers

2000+600+80+7 is the answer
the answer is
2000+600+80+7

Walmart is advertising a sale where all Lego sets are 15% off. Mrs. Snyder decides to purchase a Lego set that originally cost $39. What will Mrs. Snyder pay for the Lego set on sale?

Answers

So this is super easy :) Simply turn 15% into a decimal 0.15
5.85 is how much money she doesn't have to pay. 
So she has to pay 33. 15
Well If you start with $39 you will need to turn your 15% into a decimal which is .15 Multiply that by your 39 and you get 5.85 that is your discount price so now subtract that from 39 to get 33.15

0.64 divided by 4 in standard algorithm

Answers

Answer:

Quotient = 0.16, Remainder = 0    

Step-by-step explanation:

Standard algorithm of division is a step by step procedure to perform division.

In this question we have to divide 0.64 by 4, therefore, 0.64 is the dividend and 4 is the divisor.

Steps:

Zero times four is 0. Then we put decimal point in our quotient.

Continuing one times 4 is 4. We subtract 4 from 6 to have remaining value of 2. Then, we copy down 4. Thus, the remaining value now is 24.

Six times four is 24. Thus, the remaining value is zero.

Hence, we get the remainder of zero and quotient 0.16.

When 0.64 is divided by 4 using standard algorithm, we get 0.16.

What is Division?

Division in maths is the process of breaking a number up into equal parts, and finding out how many equal parts can be made.

Given is 0.64 divided by 4.

In order to divide 0.64 by 4, follow the given steps -

1 : 4 multiplied by 0 is equal to 0. Start writing the quotient as by writing 0 and decimal point after it.

2 : 4 multiplied by 1 is 4 and when 4 is subtracted from 6, we get 2. The quotient will now become 0.1 . Bring 4 down, next to 2.

3 : Now, 24 divided by 4 gives 6, this will leave remainder 0 and the final quotient will be 0.16

Therefore, 0.64 divided by 4 using standard algorithm, we get 0.16.

To solve more questions on Division by Standard Algorithm, visit the link below-

https://brainly.com/question/8436704

#SPJ2

A computer manufacturer built a new facility for assembling computers. There were construction and new equipment costs. The company paid for these costs and made combined profits of $10 million after 4 years while profits increased $7.5 million per year. Select the correct graph of this function.

Answers

y - intercept = -20 x - intercept = 2.666



A lab technician is diving a cell that has a diameter of 4.32 x 10^-4 millimeters. Each of the new cells has a diameter measuring exactly one half of the diameter of the original cell . Which is the diameter of the new cell ? A. 2.16 x 5^-2 B. 2.16 x 10-2 C.2.16 x 5-4 D.2.16x 10^-4

Answers

It is very simple you will just multiply it by half
4.32 × 10^-4 /2
=2.16 × 10^-4

The answer is D.
Final answer:

The diameter of the new cell, which is exactly half the diameter of the original cell (4.32 x 10^-4 millimeters), is 2.16 x 10^-4 millimeters.

Explanation:

The lab technician is dividing a cell with an original diameter of 4.32 x 10^-4 millimeters. The new cells' diameter is stated to be exactly one half of the original diameter. Therefore, to find the diameter of the new cell, simply take half of the original cell's diameter. This can be accomplished by dividing the numerical value of the diameter by 2, which would be 4.32/2 = 2.16. The exponent remains the same because the size (magnitude) of cell diameter is only halved, not the order magnitude. So the diameter of the new cell is 2.16 x 10^-4 millimeters.

Learn more about Cell Division here:

https://brainly.com/question/29773280

#SPJ3

How do you solve this math problem-2(x+3y)=18

Answers

Greetings!

Solve for x.
[tex]-2(x+3y)=18[/tex]
Distribute the Parenthesis. How? Multiply all of the terms inside the parenthesis by the number outside the parenthesis.
[tex](-2)*x+(-2)*3y=18[/tex]
[tex]-2x-6y=18[/tex]
Add 6y to both sides.
[tex](-2x-6y)+6y=(18)+6y[/tex]
[tex]-2x=18+6y[/tex]
Divide both sides by -2.
[tex](-2x)/-2=(18+6y)/-2[/tex]
The Answer Is:
[tex]x=-9-3y[/tex]
[tex]x=-3y-9[/tex]

Hope this helps.
-Benjamin

Divide.

8.64÷(−0.27)

Answers

8.64÷(−0.27)
The answer is -32.

Lia gets paid $45 an hour plus $150 each week. She hopes to earn at least $690 this week.

Answers

Assuming the question is:
 "How many hours does she have to work to reach her goal of $690"

That information can make the equation: 
money earned in a week = 45h + 150

We then sub in $690
690 45h + 150
Rearrange to find h
540 = 45h
12 = h

Lia has to work 12 hours to earn at least $690

Answer: Hi, if the question is "how many hours she needs to work this week in order to win at least $690"

then, per week Lia wins:

$150 + $45*x,

where x is the amount of hours that she worked in the week.

then the equation we need to solve is:

$150 + $45*x = $690

$45*x = $690 - $150 = $540

x = 540/45 = 12

then she needs to work at least 12 hours this week in order to win at least $690.

Do you think it is okay to make friends over the internet or is it too dangerous to trust what people over the internet are saying. What should you do if you make a internet friend and they ask to meet. Should you agree or tell an adult. USE COMPLETE SENTENCES. 

Answers

I think it’s kind of ok only if they tell us sensible things. For example we might have some problems but we feel embarrassed to tell someone who we know so we want good advice from someone who doesn’t know me and can’t judge me based on anything other than my story and reasons. But if someone tells me we should you should refuse and if they start bothering you then you should tell an adult. Hope this helps!!!
Final answer:

Making friends on the Internet can be beneficial, especially for those who struggle with face-to-face interactions, but it is vital to remain cautious and maintain online safety by keeping personal information private and consulting adults about meetings.

Explanation:

Making friends over the Internet has become increasingly common and can be a positive experience; however, it comes with its risks. Understanding the nature of online relationships and knowing how to navigate them safely is crucial. When interacting online, remember that not everything shared may be private, and it's essential to be cautious about what personal information you disclose. If an Internet friend asks to meet in person, it is vital not to agree to it without consulting an adult. Adults can provide guidance, help assess the situation, and ensure that if a meeting is to occur, it takes place in a safe, public environment under the right supervision.

The Internet indeed offers opportunities to form meaningful connections, especially for those who may find face-to-face interactions challenging. Research has highlighted that virtual relationships could be as intimate as in-person ones. Yet, it is critical to stay vigilant about the risks associated with forming friendships online, such as privacy concerns, the potential for misinformation, or encountering online predators. Keeping personal information private, being careful about accepting friend requests from strangers, and paying attention to privacy settings are essential steps to maintaining online safety.

In summary, while making friends over the Internet can have its advantages, one must exercise caution and involve an adult when decisions about meeting such friends arise.

Other Questions
What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Why is it important that melanin is present in its highest concentration in the keratinocytes at or near the basale layer of cells? What conclusion can you draw from the fact that Spanish and Portuguese are the most commonly spoken languages in Latin America? A)Latin Americans have chosen to speak Romance languages. B)Latin Americans were born in Spain and Portugal and then moved. C)Spain and Portugal colonized Latin American nations during the 15th and 16th centuries. D)Many Latin Americans travel to Spain and Portugal and learn the language while visiting. which function represents a vertical stretch of an exponential function Steam Workshop Downloader