Answer:
Sea and land breezes over a large region that change direction with the season are called monsoons.
Explanation:
These are seasonal changes in the direction of winds in a particular region which causes its wet and dry seasons.These monsoons are often associated with the Indian Ocean and tend to move from cold to warm regions in a particular region.
Hope this helps!! :)
The large seas and land breezes over a large region shift direction with the seasons are called monsoons.
What are Monsoons?A monsoon is a change in wind direction that occurs once a year (seasonal shift). During the summer, it can result in significant rains, while during the winter, it can result in dry periods.
It is also known as a seasonal shift in the direction of a region's predominant winds, or greatest winds. Monsoons are responsible for rainy and dry seasons throughout most of the tropics.
Monsoons typically blow from the cold to the warm. Most of Southeast Asia's climate is determined by the summer and winter monsoons.
Learn more about monsoons here:
https://brainly.com/question/21280463
The Serengeti plains are part of the African savanna ecosystem and are home to a variety of different species of plants and animals. The Serengeti plains experience a seven-month period of seasonal drought each year, during which the ecosystem receives only four inches of rain and the availability of some resources becomes very scarce. Which type of limiting factors does the seasonal drought in the Serengeti plains affect?
Answer:
Water is the limiting factor that the Serengeti plains affect.
Explanation:
From the explanation, Serengeti plains experience a seven-month drought during which only 4 inches of rain is received.
This is a limiting factor that maimes the growth and spread of organisms across the plain.
Due to less amounts of rainfall, there shall be minimal growth of vegetation, this in turn shall lead to loess supply of food for organisms and hence higher mortality rate and low birth rate.
Answer:
density- independent factors
Explanation:
The history of Taurus
Answer:
The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle. The sign of Aries represents the beginning of spring and with it the beginning of life, while Taurus is a fixed sign that continues what Aries has started. Life is in full bloom in the sign of Taurus.
The stars in Taurus constellation host two open clusters, the Pleiades and the Hyades and are mostly located at the end of the sign of Taurus and the beginning of the zodiacal sign of Gemini. In the Early Bronze Age it marked the location of the Sun during the spring equinox, just like the constellation of Aries represented the equinox over 2000 years ago. The constellation of Taurus was linked to it 5000 to 1700 BC, before the precession of the equinox moved our perspective to the sign of Aries.
Answer:
The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle.
Explanation:
Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology
Answer:taxonomy
Explanation:
Modern Taxonomy
Carolus Linnaeus it credited with developing the scientific naming and classification system.
Hope this helps!!
How does the biological species concept identify two different species?
A. reproductive isolation
B. asexual reproduction
C. interaction between two species
D. the difference in the way of life
Answer:
D or C
Explanation:
just for the heck of it
Answer:
i think the answer is C.
Hope it helps
Explanation:
The information contained in the table could be used _______________________.
Can you attach the table so I can see it??
Answer:
A
Explanation:
to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.
Which process involves making glucose without energy from sunlight?
A. Photosynthesis
B. ATP formation
C. NADPH formation
D. Chemosynthesis
Answer:
Chemosynthesis
Explanation:
Its right trust me
the correct answer is chemosynthesis <3
Why was T.Rex able to see the insurance broker in the bathroom
Answer: Because it was tall?
Explanation:
An infected mosquito may potentially bite a person with untreated or inadequately treated malaria. These disease-carrying mosquitoes can transfer the sickness to others by biting and infecting healthy people. Direct human-to-human transmission of malaria is not possible.
What plasmodium cause disease to healthy individual?Rhonaldros was tackling a challenge. A healthy individual couldn't be bitten by musketoe because of the sickness. He was able to recognize particular species of human-biting scio females and Avillus moscleto.
Infectious stages of the plasmodium are transmitted to the individual who was bitten by the mosquito when it was carrying plasmodium. When a healthy individual contracts malaria, this is used to treat the transmontane form of the disease. The truth is that musquetoe can spread malaria to a healthy individual. The moschitoeon was not bitten by the rans.
Therefore, T.Rex, able to see the insurance broker in the bathroom.
Learn more about plasmodium here:
https://brainly.com/question/7624790
#SPJ2
Which part of a sperm cell is responsible for providing the cell's energy?
A.
round head
B.
mitochondria section
C.
flagellum
D.
cell wall
B. The mitochondria section stores all the cells energy
How is a scientific law different from a scientific theory?
A. A theory becomes a law after a long period of time has passed.
B. theory is why something happens and a law is how something happens.
C. A theory cannot be disproved but a law can be disproved.
D. A theory is used for biology and chemistry and a law is used for physics.
A scientific law is a concise statement that describes a pattern or behavior in nature, while a scientific theory is a more complex and dynamic explanation of a group of related phenomena.
Explanation:A scientific law is a concise statement that describes a pattern or behavior in nature that is supported by evidence and repeated experiments. Laws are often expressed in the form of a single mathematical equation. On the other hand, a scientific theory is a more complex and dynamic explanation of a group of related phenomena. Theories attempt to explain why nature behaves the way it does, while laws describe what happens.
Final answer:
A scientific law describes how something happens using a concise pattern in nature, often expressed as a mathematical equation, like F = ma for Newton's second law of motion. A scientific theory is a more complex explanation of why phenomena occur, such as the Theory of Evolution or the Theory of Relativity, and evolves over time as new evidence is found.
Explanation:
The question on how a scientific law is different from a scientific theory can be best answered by choice B: A theory explains why something happens and a law describes how something happens. A scientific law uses concise language to express a generalized pattern observed in nature, often supported by significant scientific evidence and can be demonstrated through repeated experiments. Laws can typically be distilled into mathematical equations or principles. An example is Newton's second law of motion, represented by the equation F = ma, which describes the relationship between force, mass, and acceleration.
On the other hand, a scientific theory is more complex and dynamic, providing an overarching explanation for a group of related phenomena based on a body of evidence. Theories, such as the Theory of Evolution or the Theory of Relativity, are comprehensive and explain why things occur as they do in nature. They are not concise enough to be summarized into a single equation or statement. Unlike a law, a theory does not transform into a law over time; they continue to evolve as new evidence emerges.
A pure substance has a/an _______ composition.
A/An _______ is composed of two or more types of matter that can be present in varying amounts.
A solution is a/an _______ mixture.
A mixture that is not uniform throughout is a/an _______ mixture.
A pure substance that cannot be broken down chemically is a/an _______.
A characteristic of matter that’s not associated with a change in its chemical composition is known as a/an _______ property.
Wax melting is an example of a/an _______ change in the state of matter.
A banana peel turning brown is an example of a/an _______ change in the state of matter.
Answer:
constant
mixture
homogeneous
heterogeneous
element
physical
physical
chemical
Explanation:
A good answer should contain the following:
got this from penn foster
A pure substance has a/an constant composition. A pure substance is defined as the substance that has a fixed chemical composition throughout such as water, nitrogen and air.
A/An mixture is composed of two or more types of matter that can be present in varying amounts. A mixture is composed of one or more pure substances in varying composition.
A solution is a/an homogeneous mixture.
A mixture that is not uniform throughout is a/an heterogeneous mixture.
A pure substance that cannot be broken down chemically is a/an element.
A characteristic of matter that’s not associated with a change in its chemical composition is known as a/an physical property.
Wax melting is an example of a/an physical change in the state of matter.
A banana peel turning brown is an example of a/an chemical change in the state of matter.
For more details regarding physical and chemical property of matter, visit:
https://brainly.com/question/13339068
#SPJ2
A population of 20 monarch butterflies colonizes a meadow. The meadow's carrying capacity for monarch butterflies is 5,000 individuals. What statement best describes the growth of the population of monarch butterflies after the meadow is colonized?
A.
The population grows at a constant rate until it approaches 5,000 individuals, and then its growth rate increases.
B.
The population grows exponentially until it approaches 5,000 individuals, and then the population size begins to decrease.
C.
The population grows exponentially until it approaches 5,000 individuals, and then its growth rate decreases.
D.
The population grows at a constant rate until it approaches 5,000 individuals, and then the population size remains stable.
Answer:
The only possible answer is D, which states that the population will reach 5000 and after that the growth will stabilise (exactly what would hapen in a logistic growth).
Hope This Helps! Have A Nice Day!!
Answer:
The correct answer is option D, that is, the population grows at a constant rate until it approaches 5,000 individuals, and then the population size remains stable.
Explanation:
The maximum capacity of the monarch butterfly, which can thrive in the meadow is 5000, which signifies that the population of twenty butterflies will continue to grow unless and until it attains the population of 5000.
In case if the growth of the population takes place exponentially, then there would be an end and the limit of 5000 would not have any significance. However, if the growth of the population takes place logistically, then the end of the growth would be the same as the limit that signifies that the 5000 limits would exhibit significance.
Thus, the only probable answer would be option D, that is, the population will attain 5000 mark and post that the growth will become stable, which precisely takes place in a logistic growth.
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Sunlight-Rose-Honeybee-Skunk-Eagle
study the food chain above. if the population of homeybees had a major increase, which of the following would most likely happen.
The rose population would decrease because the bees would need more food. Since the skunk has more food, it would increase and the eagle population would probably increase too because of more access to skunks. The eagle interpretation may be true unless the eagle is perceived as a scavenger. Then the population would most likely stay the same. The sun would stay the same because it is an abiotic factor in an ecosystem. your welcome fam
Sunlight is the same (obvs) then roses decrease because there are more honeybees to eat them. Skunks would probably increase bc there are lots more honeybees to eat but then honeybees decrease probably. Eagles increase cos skunks increased after honeybees increased. Basically sunlight stays same, roses dercrease and the rest increase.
Anyone can help to explain this: Many people (even health professionals) tend to think that overweight people can never be malnourished because they are healthy.
Well, I don't believe that you can be overweight and healthy unless it is muscle mass that makes you "overweight". Many overweight people actually are malnourished because they are likely eating unhealthy processed food such as fast food. When you eat this constantly, you are depriving your body of essential vitamins and nutrients. These nutrients and vitamins are essential for building muscle mass, so is exercise. If you are overweight, you are probably not exercising like you should. Unhealthy food choices, low muscle mass, and lack of exercise can dramatically lower one's metabolism. If your metabolism is slow, it takes longer for your body to take in the needed nutrients and vitamins.
Why is carbon dioxide considered a greenhouse gas? (A) It is released when fossil fuels are burned. (B) It is part of the carbon cycle, which is also known as the greenhouse cycle. (C) It can absorb infrared radiation. (D) It is responsible for protecting organisms from UV radiation.
Answer:
C It can absorb infrared radiation
Explanation:
What happens when an electrical gradient and a chemical gradient are applying opposite forces to active transport?
Answer:
Active transport utilises a carrier transport protein molecule that hydrophilic pathway is specific to allow molecules to pass through one directional. Hence, nothing happens to active transport.
Answer:
The active transport keeps the ion balance across the membranes.
Explanation:
The active transport needs both gradients to work one against each other to move the ions across the membranes, that means opposite forces will keep the active transport working.
Which part of a mushroom can you see above the ground?
Answer:
The correct answer is reproductive part.
Explanation:
The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.
Which of the following is not true of most sex-linked traits?
A. Located on the X chromosome
B. Located on the autosomes
C. Usually recessive
D. Usually seen in males
Answer:
a
Explanation:
Sex-linked traits refer to those associated with genes located on sex chromosomes. They are typically recessive and more common in males. The statement that these traits are located on autosomes, which are non-sex chromosomes, is incorrect.
Explanation:In studying genetics, we learn that sex-linked traits are primarily associated with genes located on sex chromosomes. These traits, more often than not, are recessive and more common in males, as they carry only one X chromosome and, therefore, express all traits that are linked to this chromosome.
Yet, the statement that sex-linked traits are located on autosomes is not true. Autosomes are all the other chromosomes that are not sex chromosomes. Hence, the answer to your question is option B: Sex-linked traits are not located on the autosomes.
Learn more about Sex-linked Traits here:https://brainly.com/question/1381309
#SPJ3
How do invasive species disrupt an ecosystem? Describe at least one example of when invasive species have disrupted an ecosystem. Your example could be a plant, animal, fungus, ext. (please please please help!!)
Answer:
Explanation:
I think one of the most invasive species is perhaps the Dandelion. Who hasn't had a fit when we see them change from yellow to gray. The yellow is pretty, but the gray means it is ready to spread its seed to create more trouble.
Dandelions can be killed with herbicides, but I think you'd be as well off putting up with the dandelion. The herbicides have an unproven effect on our health.
The dandelion was introduced into the Americas in the mid 1600s and was used as food and had medical properties. Since then, because it has no common enemy in nature, it has spread the entire width of the continent. Rather amazing, I think.
need help asap!!!
Sound waves travel down the ear canal and strike the _____, causing it to vibrate and to pass the vibrations on to small bones in the middle ear.
(A)eardrum
(B)anvil
(C)stirrup
(D)cochlea
(A) eardrum
Explanation:A. Eardrum
Explanation: Sound waves enter the outer ear and travel through a narrow passageway called the ear canal, which leads to the eardrum. The eardrum vibrates from the incoming sound waves and sends these vibrations to three tiny bones in the middle ear.
Nitrogen oxide is released when _____. hydrocarbons combine with water plants make food through photosynthesis special bacteria break down nitrogen fuels are burned at high temperatures
Answer:
Nitrogen fuels are burned at high temperatures
Explanation:
When the nitrogen-based fuel is burned at high temperatures, the nitrogen in the fuel combines with oxygen to form nitrogen oxide. While this can occur n combustion engines in cars, leading to pollution, the same occurs naturally espically during lightning strikes that cause the nitrogen gas in the atmosphere combine with oxygen. NO is an airway irritant.
Answer:
it´s D I got it correct
There are several problems with classifying organisms into six kingdoms of life. One problem is that _______ aren't well defined and are very diverse. In addition, any eukaryotes that don't fit into other kingdoms are placed in this kingdom. A. fungi B. plants C. archaea D. protists
Answer:
D. Protists
Explanation:
Kingdom protista is composed of mostly unicellular organisms, but they do include some multicellular organisms. Like your problem says, eukaryotes that do not fit in other kingdoms are placed in this kingdom. As a result, even members of this kingdom do not share many similarities, as the organisms here are diverse.
The answer is D. Protists
At which region of a state's geology would an earthquake be more likely?
Near a divergent boundary of two plates
At the site of geologic uplift where island chains form
At the site of a convergent boundary as plates move together
Around a transform boundary between two plates that slide past each other
Answer:
Around a transform boundary between two plates that slide past each other
Explanation:
Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.
Answer:
C. It is caused by a virus, not a bacterium
Explanation:
The answer is C influenza is caused by viruses not a bacterium
viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood
What evidence makes scientists think that land plants evolved from green algae
Answer:
Because the algea was not strong enough yet to live on its own and had to stay close a water source, where it could get water and sunlight without doing any work.
Explanation:
Scientists believe that land plants evolved from green algae due to shared physical traits, biochemical pathways, and their common monophyletic heritage. These include similar mechanisms of cell division, storage of starch, the presence of chlorophyll as a photosynthetic pigment, and being part of the same photosynthetic lineage, the Archaeplastida.
Explanation:The evidence that leads scientists to believe that land plants evolved from green algae is rooted in various shared characteristics and evolutionary lineage. Green algae, especially the Charophytes, share several traits with land plants, such as having chlorophyll a and b as photosynthetic pigments, cellulose cell walls and starch as a storage molecule. Another crucial point to note is a common mechanism of cell division and significant biochemical pathways.
Furthermore, evolutionary thought indicates that all plants, including green algae and land plants, are monophyletic, meaning they descend from a common ancestor. The transition from water to land posed significant challenges to plants in the form of avoiding drying out, spreading reproductive cells in air, developing structural support, and capturing sunlight. Characteristics like these were developed during evolution by both green algae and land plants.
Lastly, the Archaeplastida, which includes green algae and land plants, became photosynthetic through an endosymbiotic relationship with a green, photosynthetic bacterium around 1.65 billion years ago. This lineage evolved into what we know today as red and green algae, and eventually land plants such as mosses, ferns, gymnosperms, and angiosperms. These shared traits and the evolutionary history demonstrate the strongly supported theory that land plants evolved from green algae.
Learn more about Evolution of Land Plants here:https://brainly.com/question/12045339
#SPJ3
Which event would MOST LIKELY speed up the process shown in the diagram?
A) another ice age
B) continental drift
C) a reversal in Earth's magnetic field
D) an increase in atmospheric carbon dioxide
an increase in atmospheric carbon dioxide
Answer: D
Answer: D) an increase in atmospheric carbon dioxide
Explanation: usatestprep approved
A nerve impulse travels from one cell to another by passing
A- one axon to another axon
B- one dentrite to an axon
C- one axon to a dentrite
D- one dentrite to another dentrite
**WILL MARK BRAINLIEST AND THANK YOU**
Forensic Science
Which information is necessary to determine the speed of a vehicle in an accident?
A. Distance between tires and length of the skidmarks
B. Length of skid marks and type of pavement
C. Length of skidmarks, type of pavement, and wet or dry conditions
D. Length of skidmarks alone
Answer:
The correct answer is C; Length of skidmarks, type of pavement, and wet or dry conditions
Answer:
Explanation:
c
helped needed asap! urgent
Answer:
the answer is parasitism
Explanation:
the parasite benefits by taking nutrients, and the other is losing it.
Answer:
The answer is Parasitism
Why did Isaac Newton conclude the universe was static? Was he correct?
He thought the ‘stuff’ (celestial bodies) in the universe that had mass attracted each other through the force of gravity. Therefore even the bodies at the edge of the universe would be attracted by gravity by the bodies inside the universe preventign them from moving further outward.
He was wrong, however, because it has been discovered, using Doppler shift effect, that the universe is actually expanding.