pastel de tres leches is made with three types of milk and ____. a) cream cheese b) ice cream c) sweet potatoes d) sponge cake

Answers

Answer 1
The answer is D) sponge cake

Related Questions

How do you say this sentence in Spanish?
The book is under the desk.

A.
El libro está debajo del escritorio.

B.
El libro está encima del escritorio.

C.
El libro está delante del escritorio.

D.
El libro está al lado del escritorio.


Answers

The correct answer is A - El libro esta debajo del escritorio. Debajo means below/under 

Answer:

its A

Explanation:

¿Què es necesario para tener una ciudad Hermana?

Answers

speak english please.
Your asking "what is necessary to have a sister city?" That doesn't make sense, rephrase it

To talk about something you like to do, what do you add to Me gusta?

A. an infinitive

B. a cognate

C. a vowel

D. the word pues

Answers

i think the answer isD the word pues

A. an infinitive 

E.g.
Me gusta cantar (I like to sing)

Tu ______ en la escuela

Answers

La frase completa será: Tú Estás en la escuela

Una escuela es un lugar donde los niños y jóvenes van a aprender. Es un lugar donde pueden aprender sobre diferentes temas, como matemáticas, ciencias, historia y literatura. También pueden aprender sobre diferentes culturas y formas de pensar.

Los niños y jóvenes van a la escuela para prepararse para la vida adulta. Allí aprenden las habilidades y el conocimiento que necesitan para tener éxito en la escuela, en el trabajo y en la sociedad.

La escuela también es un lugar donde los niños y jóvenes pueden hacer amigos y aprender a trabajar juntos. Es un lugar donde pueden desarrollar sus habilidades sociales y emocionales.

Fill in the blank in the following sentence with the appropriate verb from below.

Tu no ________ triste.

A) estoy
B) estas
C) esta
D) estais

Answers

the correct answer is b :estas

its going to be the B 

Which of the following means "He has just left my house"? (3 points) Question 7 options: 1) Él acabo de llegar a mi casa. 2) Él acaba de salir de mi casa. 3) Él acaba de llevar a mi casa.. 4) Él acaba de llegar a mi casa.

Answers

2. El acaba de salir de mi casa. It does mean what youre asking (:

Answer: The right answer is the 2) Él acaba de salir de mi casa.  

Explanation: Just to elaborate a little on the answer, it can be added that the verb "acabar" followed by "de" in Spanish means that something just happened. In addition, the verb "salir" means to leave. "Llevar" and "llegar" mean to carry/bring and to arrive, respectively. Therefore, the right answer is the number 2.    

¡Rico! ¿_______ tal? a. Cuántos b. Cómo c. Qué d. Dónde

Answers

The answer is C.que 
Rico que tal?
The answer would be C, Qué.

"Qué tal" means in English, "How are you?"

Historias en la que los defectos de un personaje lo llevan a su destrucción

Answers

to english
: stories in which the defeats of a character leads to its destruction.

what drink do you recommend? in spanish

Answers

the drink i recommend in Spanish is water=agua

Select the answer that best completes the sentence.
Hay un sofá en __________. (4 points)
la cocina
el garaje
el jardín
la sala

Answers

La cocina is kitchen
El garaje is garage
El jardin is garden

The answer is la sala

It takes 50 seconds to discharge 750 cc from a small sprayer how long should you spray if you want to discharge only 330 cc

Answers

420 I think I'm not sure tho

Which of the following adjectives means the opposite of difícil?

A. Aburrido
B. Interesante
C. Fácil
D. Ocupado

Answers

Which of the following adjectives means the opposite of difícil?
C. Fácil

The correct answer is C. Fácil

Explanation:

Words have an opposite meaning of another word are known as antonyms or "antónimos" in Spanish. In the case fo the word "difícil" that is equivalent to the word "difficult" in English, this is an adjective used to describe tasks, activities that require a great effort. For example "El examen es difícil" (The exam is difficult). In this context, the word with an opposite meaning or "antónimo" is "fácil" because this word describes activities that require little effort. Also, other options are not possible as "aburrido" means boring, "interesante" means interesting and "ocupado" means busy which is not related to the word "difícil".

The Spanish word for "skirts" is las


Answers

No it is not las it is called faldas

Write a paragraph in Spanish about the farm, using the following questions as a guide. Be sure to use TWO COMPARATIVE ADJECTIVES in question number 4.
1. ¿Vives cerca de (near) una granja?
2. ¿Te gustan los animales?
3. ¿Cuál es tu animal favorito (de la granja)? ¿Por qué?
4. Describe tu animal favorito, usando (using) algunos adjetivos COMPARATIVOS de la sección A.

grande alto débil (weak) flaco largo bonito
pequeño bajo fuerte gordo corto feo
tímido valiente rápidamente lentamente mejor peor
inteligente interesante magnífico tonto sucio (dirty) limpio

Answers

No se ?????????????? ok :(

Historically, most flamenco came from los ____________, or the gypsies.

Answers

I think it's spanish people, is it just one word?

Which word best completes this sentence?
El señor Norton _____ el español.

A.enseñamos

B.enseña

C.enseño

D.eneseñan

Answers

Which word best completes this sentence?
El señor Norton enseña el español.

Answer:

ensena

Explanation:

Historias en las que los defectos de un personaje lo llevan a su destrucción

Answers

esa historia esta basada en una persona que trata deshacer su propio destrucción en lo que llevan su defectos

Answer:

esa historia esta basada en una persona que trata deshacer su propio destrucción en lo que llevan su defectos

Explanation:

Spanish question:
Which of the following do you use when asking about two choices?

A. ni . . . ni

B. o

C. pues

D. hay

Answers

use B because it makes more sense and I use it all the time when asking a question
Hi. Which of the following do you use when asking about two choices? The answer: B- o.

Which word correctly completes this sentence?

No hay nadie en la clase que __________ un lapicero.

tiene

tener

tenga

tienen

Answers

Tenga* is the best answer
No hay nadie en la clase que __________ un lapicero.Answer: Tenga

Which word correctly completes this conversation?

Miguel: ¿Qué necesitas para la clase de arte? Ana: ________ los lápices de color.

Necesité


Necesitaron


Necesitó


Necesito

Answers

It would be C. Necesito (without accent)
it might be the necesito

Yo no (blank) (conseguir) películas de acción en la biblioteca.

Answers

Yo no consegui peliculas de accion en la biblioteca.

Which word would you use to identify the boots (botas) that are closest to you?

estas
estos
aquellas
esa

Answers

Correct answer:estas

Estas is the feminine plural form of the demonstrative adjective este that is used to point out something near to the speaker in space or time. This type of adjectives demonstrate a quality about the noun they modify. Here that quality is the location in respect to the speaker or the listener.Since botas is a feminine plural noun, we use estas. Finally:

Estas botas

Fill in the blank with the correct Spanish words. En la cara hay _______.

A. dos muñecas
B. dos narices
C. dos ojos
D. dos manos

Answers

en la cara hay dos ojos.
in the face there are two eyes

The sentence says "On a face there are ___"

A states "two dolls"
B states " two noses"
C states "two eyes"
and D states "two hands"

So the answer is C two hands. :)

Read the following statement and decide which of the answers is correct.
Trabajé desde las tres hasta las cinco. Ahora son las seis. (2 points)

Options:
1) Hace dos horas que trabajo.
2) Hace una hora que trabajé.
3) Trabajé en el supermercado.
4) Hace dos días que trabajo

Answers

2) Hace una hora que trabaje. Is the correct answer

Answer:

2) Hace una hora que trabajé.

Explanation:

Trabajé desde las tres hasta las cinco. Ahora son las seis.

Hace una hora que trabajé.

I worked from three to five. Now it's 6pm.

1) I have been working for two hours.

2) I have worked one hour ago.

3) I worked in a supermarket.

4) I have been working for two days.



14.

In which of the following sentences does fui mean "I was"?
(1 point)
Fui al médico
Fui a Madrid.
Fui estudiante.
Fui ayer.


15.

Ellos _______ un perro blanco.
(1 point)
tuvimos
tuvisteis
tuvieron
tuvo


16.

Which Colombian city is located in the center of the country?
(1 point)
Bogotá
Cali
Cartagena
Medellín


17.

Where can you go to see the Muisca Raft?
(1 point)
Colombian National Musuem
Simón Bolívar Metropolitan Park
Museo del Oro
Salitre Mágico

Answers

14- fui estudiante which means era or i was.
15- tuvieron por Que El pronombre ellos concuerda con tuvieron
16-I would say Bogota since is the capital , but I am not sure of it.
17-

1. The right answer is Fui estudiante

In English this sentence means: I was a Student. Fui is the conjugation of the verb ser (to be) for the pronoun yo in the preterite tense. In Spanish, we use the preterite to describe actions completed at a certain point in the past. On the other hands, the other sentences use the same conjugation (fui) but the verb that they use is ir (to go), so:

Fui al médico ⇒ I went to the doctor

Fui a Madrid ⇒ I went to Madrid

Fui ayer ⇒ I went yesterday


2. The right answer is tuvieron

So:

Ellos tuvieron un perro blanco.

whose meaning in English is:

They had a white dog

Tuvieron is the conjugation of the verb tener for the third-person plural (ellos - they) also in the preterite. So, this sentence means that more than one people had a white dog at a certain point in the past until this animal probably died.

3. The right answer is Bogotá

Bogota is located in the center of Colombia. It has a population of more than 8 million of people. The area of this city has 1587 km² and was founded in 1538 by Gonzalo Jiménez. Bogota is the considered to be the third-highest city in South America.

4. The right answer is Museo del Oro

In English, Museo del Oro means Gold Museum. The Muisca Raft is an artistic figure located in the Gold Museum. This piece is 19.5 cm long, 10.1 cm wide, and 10.2 cm high. It was made in the period of Muisca Culture. The figure that stands in the center is considered to be a cacique. Also, other twelve minor figures seem to be surrounded it.

4. Which natural landmark is found in Canaima National Park? (1 point)
Angel Falls
Ávila Mountain
Lake Maracaibo
Victoria Falls


5. Andrés Bello's Las silvas americanas described _______. (1 point)
the language differences in the Spanish of the Americas
daily life on his expeditions with Alexander von Humboldt
lessons taught to Simón Bolívar
the culture and landscape of South America

Answers

4. Angel Falls is found in canaima national park. I don't know the answer to 5

4. Angel Falls is the landmark found in Canaima National Park.

5. The culture and landscape of South America.

I hope I helped (even though I answered this question after you asked so long ago)

Complete the sentence with the correct form of the verb gustar and the indirect object pronoun (me, te, le, etc).

A mí __________ __________ estudiar mucho en la escuela.

When entering your answers for fill in the blank and essay questions, please be sure to use accent marks and/or correct punctuation to avoid your answer being marked incorrect.

Answers

Ejercicio : Complete the sentence with the correct form of the verb gustar and the indirect object pronoun (me, te, le, etc).

A mí me gusta estudiar mucho en la escuela.
#1) Complete the sentence with the correct form of the verb gustar and the indirect object pronoun (me, te, le, etc).

Answer: The correct way to complete the sentence presented above is the following. A mí me gusta estudiar mucho en la escuela. This translated to English means: I like to study a lot in school. As you can see I used the verb gustar and the indirect pronoun me.

I hope it helps, Regards. 

What did bolivia's housing look like?

Answers

what you mean About this
Eres un pinche mocoso feo

Finish the sequence:
martes, miércoles, _______
a)domingo
b)jueves
c)lunes
d)sábado

Answers

jueves - B

Tuesday, Wednesday, and Thursday  

¿Cuáles son ejemplos del voseo?
¿Qué escribes?
¿Cómo andás?
¿Adónde vas?
¿Dónde vivís?

Answers

¿Cómo andás?, ¿Dónde vivís?

No es lo que escribes.

Yo soy Bueno.

me voy a la escuela.

Yo vivo en París.

Right answers: ¿Cómo andás? and ¿Dónde vivís?

The "voseo" is used as the main form of the second person of the singular tú (you) in the River Plate Spanish of Argentina, Uruguay and eastern Bolivia, and in the Paraguay's spanish.

Nevertheless, "vos" is also used in some regions of: Costa Rica, Bolivia, Chile, Peru, Ecuador, Colombia, Venezuela, Panama, Nicaragua, Honduras, El Salvador, Guatemala, Mexico and Cuba.  Although, this is not used in all the countries of Latin America or all its regions.

It should be noted that this linguistic phenomenon within the Spanish (Castilian) language in which the pronoun "vos" is used along with certain particular verb conjugations instead of using the pronoun "tú" in situations of familiarity.

For example, the following two questios:

1. ¿Cómo andás (vos)?  

Is used instead of ¿Cómo andas (tú)? Or ¿Cómo estás tú? (How are you?)

2. ¿Dónde vivís (vos)?  

Is used instead of ¿Dónde vives (tú)? (Where do you live?)


Other Questions
A number has the digit 8 and 4 .to the nearest 10.the number round to 50.what is the number? are fruit battery's good for the enviorment a landscaper estimates that a set of plants can be installed in six hours by 12 workers the landscaper wants to finish a set of plants in 4 hours assuming that the variables are inversely related how many workers should the landscaper bring to the job How did airports encourage city growth ?a. they promoted the building of hotels, restaurants,services and rapid transit to accommodate travelers b. they are so big and require so much land that they need a larger population to be sustained c. they limit the effects of gridlock and make travel more pleasantd. they were responsible for transporting over 13 billion tons of materials Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Steam Workshop Downloader