Final answer:
Birds and dogs use DNA to build their bodies because they share the same basic biochemical components and genetic structure, despite being different species. DNA sequences reflect evolutionary relationships, and organisms that share a common ancestor have more DNA in common.
Explanation:
Birds and dogs both use DNA as instructions for building their bodies because, despite the apparent differences, they share the same biochemical building blocks, such as amino acids and nucleotides that make up proteins and DNA respectively. All living organisms, from bacteria to mammals, have DNA that determines their development, and this DNA is composed of the same basic structure across the diverse array of life.
The genetic code contained within DNA is practically universal, and the degree of similarity between the DNA sequences of different species can reflect their evolutionary relationships. For example, even though whales and sharks are both aquatic animals, a whale actually shares more DNA sequences in common with a horse than with a shark, due to their closer evolutionary ties as mammals. The similar construction of appendages in humans, dogs, birds, and whales further indicates that these organisms share a common ancestor.
Just as members of the same human family have more DNA in common with each other than with unrelated individuals, the same principle applies across species. Organisms that are more closely related will have a greater amount of DNA alignment, sharing more characteristics and behaviors.
How does introduced species harm our planet?
Please someone answer this
ASAP!!!
Introduced species can harm our planet because in some regions of the world we are not prepared for their type of species, which can all in all cause damage.
Answer: alteration of the ecosystem
Explanation:when a new specie is introduced into the ecosystem it may have profound affects in the ecosystem and may also be called an invasive specie.
The affects that it may have on the ecosystem include
1.outcompeting the native specie and sometimes even leading to their extinction because the new specie may be modified in such a way as to have better chances of survival in the ecosystem because of their evolved genetics e.g : the new specie may encounter a native and non evolved specie of the ecosystem and compete with it for survival leading to reduction and even complete eradication of the native specie
I need help now
Which type of bacteria is shown in the image?
A. bacillus
B. coccus
C. spirillum
D. cholera
Answer is B bacillus
The bacteria shown in the image are bacillus bacteria. Therefore, option A is correct.
Bacillus bacteria are a group of rod-shaped, gram-positive bacteria that belong to the genus Bacillus. They are characterized by their ability to form endospores, which are dormant structures that allow them to survive in harsh conditions. Bacillus bacteria are widely distributed in nature and can be found in soil, water, and various organic materials.
Some notable species of Bacillus include Bacillus subtilis, Bacillus cereus, and Bacillus anthracis. Therefore, option A is correct.
Learn more about Bacillus bacteria, here:
https://brainly.com/question/11201874
#SPJ4
The history of Taurus
Answer:
The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle. The sign of Aries represents the beginning of spring and with it the beginning of life, while Taurus is a fixed sign that continues what Aries has started. Life is in full bloom in the sign of Taurus.
The stars in Taurus constellation host two open clusters, the Pleiades and the Hyades and are mostly located at the end of the sign of Taurus and the beginning of the zodiacal sign of Gemini. In the Early Bronze Age it marked the location of the Sun during the spring equinox, just like the constellation of Aries represented the equinox over 2000 years ago. The constellation of Taurus was linked to it 5000 to 1700 BC, before the precession of the equinox moved our perspective to the sign of Aries.
Answer:
The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle.
Explanation:
Which part of a mushroom can you see above the ground?
Answer:
The correct answer is reproductive part.
Explanation:
The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.
Which process involves making glucose without energy from sunlight?
A. Photosynthesis
B. ATP formation
C. NADPH formation
D. Chemosynthesis
Answer:
Chemosynthesis
Explanation:
Its right trust me
the correct answer is chemosynthesis <3
How do invasive species disrupt an ecosystem? Describe at least one example of when invasive species have disrupted an ecosystem. Your example could be a plant, animal, fungus, ext. (please please please help!!)
Answer:
Explanation:
I think one of the most invasive species is perhaps the Dandelion. Who hasn't had a fit when we see them change from yellow to gray. The yellow is pretty, but the gray means it is ready to spread its seed to create more trouble.
Dandelions can be killed with herbicides, but I think you'd be as well off putting up with the dandelion. The herbicides have an unproven effect on our health.
The dandelion was introduced into the Americas in the mid 1600s and was used as food and had medical properties. Since then, because it has no common enemy in nature, it has spread the entire width of the continent. Rather amazing, I think.
What happens to a virus involved in the lysogenic cycle?
Answer:
The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.
Figure 10-4
49
replicate DNA
a
In Figure 10-4. what role does structure A play in mitosis?
b. increase cell
connect to spindled dissolve nuclear
volume
fibers
envelope
Figure 10-5
Structure A in Figure 10-4 is the centrioles. role does structure A play in mitosis is: (c) connect to spindle fibers
Centrioles are paired organelles that are found in the cytoplasm of eukaryotic cells. They are composed of microtubules, which are long, thin filaments that form the structural framework of the cell. During interphase, the centrioles are located near the nucleus and are surrounded by a cloud of protein called the centrosome.
As the cell progresses into mitosis, the centrioles replicate and move to opposite poles of the cell. This process is called centrosome separation. The centrosomes act as organizing centers for the spindle fibers, which are microtubules that extend from the centrosomes and attach to the chromosomes. The spindle fibers play a crucial role in separating the chromosomes during mitosis.
Why do geese fly together in a V formation?
Explanation:
Geese fly together in a v formation.
Geese fly together because when the first goose flaps it's wings it creates an upward force which make it easier for the second goose to fly.
In this way the force increases and the effort the last goose has to spend to fly decreases a lot.
Hope it helps you.
please mark as brainliest.
Answer:
B. to save energy
Explanation:
ody ssey Unit 3, Assignment 2. Animal behavior and Interdependencies, page 4, under Group Animal Behavior, paragraph 2, from " The lead goose....V formation.....making their flight easier."
nowhere in my ody ssey unit materials did it mention otherwise or geese again.
At which region of a state's geology would an earthquake be more likely?
Near a divergent boundary of two plates
At the site of geologic uplift where island chains form
At the site of a convergent boundary as plates move together
Around a transform boundary between two plates that slide past each other
Answer:
Around a transform boundary between two plates that slide past each other
Explanation:
Which of the following is not true of most sex-linked traits?
A. Located on the X chromosome
B. Located on the autosomes
C. Usually recessive
D. Usually seen in males
Answer:
a
Explanation:
Sex-linked traits refer to those associated with genes located on sex chromosomes. They are typically recessive and more common in males. The statement that these traits are located on autosomes, which are non-sex chromosomes, is incorrect.
Explanation:In studying genetics, we learn that sex-linked traits are primarily associated with genes located on sex chromosomes. These traits, more often than not, are recessive and more common in males, as they carry only one X chromosome and, therefore, express all traits that are linked to this chromosome.
Yet, the statement that sex-linked traits are located on autosomes is not true. Autosomes are all the other chromosomes that are not sex chromosomes. Hence, the answer to your question is option B: Sex-linked traits are not located on the autosomes.
Learn more about Sex-linked Traits here:https://brainly.com/question/1381309
#SPJ3
The information contained in the table could be used _______________________.
Can you attach the table so I can see it??
Answer:
A
Explanation:
to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.
Frost wedging happens when__
Answer:
Frost wedging occurs as the result of expansion of water when it is converted to ice. Cracks filled with water are forced further apart when it freezes.
Answer: The correct option is water freezes inside a rock, causing it to break
Explanation:
Can a tornado pick up a person and send it to another island?
Answer: almost imposiable
Explanation: If you do happen to get picked up a tornado the longest time you will stay in it is approximately 5 minutes before it throws you out of it. If you did so happen to be swept in a tornado near a island it is possiable, but tornados over water die very very fast so this is very unlikley.
Hope this helps
Answer:
Nope.
Explanation:
Now I don't know anything about much about tornado's. But I'm pretty sure it won't pick up that person and send it to another island. I don't think the tornado have enough force to throw the person to another island. It will, however, send that person on another area maybe close to the tornado area. But yet again I don't the tornado have the abilty to do that.
Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.
Answer:
C. It is caused by a virus, not a bacterium
Explanation:
The answer is C influenza is caused by viruses not a bacterium
viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood
A geologist concludes that a rock sample is an extrusive igneous rock. Based on this information, which statement about the rock is accurate?
A. The rock formed from cooling lava.
B. The rock likely came from a pluton.
C. The rock cooled slowly over millions of years.
D. The rock formed within Earth's crust.
The correct answer is D
The accurate statement about an extrusive igneous rock is that it formed from cooling lava, which cools quickly at the Earth's surface, leading to a finer-grained texture.
Based on the information that a geologist concludes a rock sample is an extrusive igneous rock, the accurate statement about the rock is A. The rock formed from cooling lava. Extrusive igneous rocks such as basalt are formed above the surface when molten rock, known as lava, extrudes onto the Earth's surface and cools quickly. This rapid cooling does not allow large crystals to form, leading to a finer-grained texture, and in some cases, such as with obsidian, a glassy texture due to the extremely rapid cooling.
Option B is incorrect because rocks that come from plutons are intrusive, rather than extrusive, and they cool slowly within the Earth's crust. Option C is incorrect as extrusive igneous rocks do not cool slowly over millions of years. Option D is also incorrect because extrusive igneous rocks form at the Earth's surface, not within the Earth's crust.
The action by which a plant grows toward sunlight is called _____.
response to stimulus
using energy
reproduction
movement
Answer: phototropism
Explanation: phototropism is a plant's response to light.
Plants growing toward sunlight is known as tropism, a response to stimuli.
Tropism is the action by which a plant grows toward sunlight. This growth movement is a response to stimuli where the plant or a part of it grows in the direction from which the stimulus originates.
How is an egg fertilized in flowering plants?
A.
with sperm
B.
by spores
C.
with an ovule
D.
with embryos
Answer: A. with sperm
Explanation:
Chapter8 lesson 2 cell structure
Answer:
Can you give me more details about this question?
Answer:
wdym
Explanation:
There are several problems with classifying organisms into six kingdoms of life. One problem is that _______ aren't well defined and are very diverse. In addition, any eukaryotes that don't fit into other kingdoms are placed in this kingdom. A. fungi B. plants C. archaea D. protists
Answer:
D. Protists
Explanation:
Kingdom protista is composed of mostly unicellular organisms, but they do include some multicellular organisms. Like your problem says, eukaryotes that do not fit in other kingdoms are placed in this kingdom. As a result, even members of this kingdom do not share many similarities, as the organisms here are diverse.
The answer is D. Protists
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Why is carbon dioxide considered a greenhouse gas? (A) It is released when fossil fuels are burned. (B) It is part of the carbon cycle, which is also known as the greenhouse cycle. (C) It can absorb infrared radiation. (D) It is responsible for protecting organisms from UV radiation.
Answer:
C It can absorb infrared radiation
Explanation:
How is a scientific law different from a scientific theory?
A. A theory becomes a law after a long period of time has passed.
B. theory is why something happens and a law is how something happens.
C. A theory cannot be disproved but a law can be disproved.
D. A theory is used for biology and chemistry and a law is used for physics.
A scientific law is a concise statement that describes a pattern or behavior in nature, while a scientific theory is a more complex and dynamic explanation of a group of related phenomena.
Explanation:A scientific law is a concise statement that describes a pattern or behavior in nature that is supported by evidence and repeated experiments. Laws are often expressed in the form of a single mathematical equation. On the other hand, a scientific theory is a more complex and dynamic explanation of a group of related phenomena. Theories attempt to explain why nature behaves the way it does, while laws describe what happens.
Final answer:
A scientific law describes how something happens using a concise pattern in nature, often expressed as a mathematical equation, like F = ma for Newton's second law of motion. A scientific theory is a more complex explanation of why phenomena occur, such as the Theory of Evolution or the Theory of Relativity, and evolves over time as new evidence is found.
Explanation:
The question on how a scientific law is different from a scientific theory can be best answered by choice B: A theory explains why something happens and a law describes how something happens. A scientific law uses concise language to express a generalized pattern observed in nature, often supported by significant scientific evidence and can be demonstrated through repeated experiments. Laws can typically be distilled into mathematical equations or principles. An example is Newton's second law of motion, represented by the equation F = ma, which describes the relationship between force, mass, and acceleration.
On the other hand, a scientific theory is more complex and dynamic, providing an overarching explanation for a group of related phenomena based on a body of evidence. Theories, such as the Theory of Evolution or the Theory of Relativity, are comprehensive and explain why things occur as they do in nature. They are not concise enough to be summarized into a single equation or statement. Unlike a law, a theory does not transform into a law over time; they continue to evolve as new evidence emerges.
40 POINTS!!! NEED GOOD ANSWERS!!!
What is the correct definition of conflict? A. A disagreement between people with opposing viewpoints. B. A negative and unjustly formed opinion, usually against people of a different racial, religious, or cultural group. C. Using another person to help reach a solution that is acceptable to both sides. D. Discussing problems face-to-face in order to reach a solution.
The statement (A) is correct. A disagreement between people with opposing viewpoints.
What do you mean by conflicts?A conflict is a struggle and a clash of interest, opinion, or even principles. Conflict will always be found in society; as the basis of conflict may vary to be personal, racial, class, caste, political and international.
Moreover, conflict is serious disagreement and argument about something important. If two people or groups are in conflict, they have had a serious disagreement or argument and have not yet reached agreement. Try to keep any conflict between you and your ex-partner to a minimum.
Therefore, the opposing force created, the conflict within the story generally comes in four basic types: Conflict with the self, Conflict with others, Conflict with the environment and Conflict with the supernatural.
Learn more about conflicts:
https://brainly.com/question/12832202
#SPJ2
A group of environmental activists in West Virginia wants to save a large forest. Which act will help them in this activity?
1. Nature conservancy
2. Toxic substance control act
3. Eastern wilderness areas act
4. Endangered species act
Answer:
A
Explanation:
Answer: 1. Nature conservancy
Explanation:
Nature conservancy is the process or initiative taken by the human society to conserve the regions of forests and the associated wildlife, fossil fuels, water sources and others. This practice will ensure that the valuable resources will remain available for the present as well as for the future generation of human beings.
On the basis of the above description, nature conservancy is the activity which will help the environmental activists to save the forests.
Solve this Sex-Linked traits practice problem
Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology
Answer:taxonomy
Explanation:
Modern Taxonomy
Carolus Linnaeus it credited with developing the scientific naming and classification system.
Hope this helps!!
In order from less complex to more complex, which level of organization is directly after tissue?
Elements. Knowledge of basic science includes the distinction between atoms and molecules, and elements, mixtures and compounds. ...
Molecules. The size of molecules varies enormously depending on the type of molecule.
Organelles.
Cells.
Tissues.
Organs.
Organ Systems.
Organism.
Answer:
a
Explanation:
hope it helps
Nitrogen oxide is released when _____. hydrocarbons combine with water plants make food through photosynthesis special bacteria break down nitrogen fuels are burned at high temperatures
Answer:
Nitrogen fuels are burned at high temperatures
Explanation:
When the nitrogen-based fuel is burned at high temperatures, the nitrogen in the fuel combines with oxygen to form nitrogen oxide. While this can occur n combustion engines in cars, leading to pollution, the same occurs naturally espically during lightning strikes that cause the nitrogen gas in the atmosphere combine with oxygen. NO is an airway irritant.
Answer:
it´s D I got it correct
what are two ways variation in the trait could be introduced into the population?
A single mutation can have a large effect, but in many cases, evolutionary change is based on the accumulation of many mutations. I hope this help you
Answer:
i sai sai
Explanation:
sia sia sai In a running relay, each runner ran an equal part of the total distance. Joseph and 3 othe